Stem-loop mmu-mir-100

Accession

MI0000692

Symbol

MGI: Mir100

Description

Mus musculus mmu-mir-100 precursor miRNA

Literature search

75 open access papers mention mmu-mir-100
(767 sentences)

Sequence

447302 reads, 571 reads per million, 92 experiments

ccuguugccacaAACCCGUAGAUCCGAACUUGUGcugauucugcacACAAGCUUGUGUCUAUAGGUAUgugucuguuagg
((((....((((.(((.((((((.(((.((((((.((......)))))))).))).)))))).))).)))).....))))

Structure

    -uugc    A   C      C   A      c  au 
ccug     caca ACC GUAGAU CGA CUUGUG ug  u
||||     |||| ||| |||||| ||| |||||| ||   
ggau     gugU UGG UAUCUG GUU GAACAc ac  c
    ugucu    A   A      U   C      -  gu 

Annotation confidence High

Comments

Mouse mir-100 is predicted [2] based on homology to a cloned miR from human (MIR:MI0000102) [1]. Its expression was later verified in mouse [3].

Genome context

chr9: 41531425-41531504 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-100

Mature mmu-miR-100-5p

• Accession: MIMAT0000655
• Description: Mus musculus mmu-miR-100-5p mature miRNA
• Sequence: 13 - AACCCGUAGAUCCGAACUUGUG - 34
• Evidence: experimental ; cloned [3], Illumina [4,6]

Mature mmu-miR-100-3p

• Accession: MIMAT0017051
• Description: Mus musculus mmu-miR-100-3p mature miRNA
• Sequence: 47 - ACAAGCUUGUGUCUAUAGGUAU - 68
• Evidence: experimental ; 454 [5], Illumina [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728


3. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


4. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


5. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73


6. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275