miRBase entry: mmu-mir-337

Stem-loop mmu-mir-337


Accession
MI0000615
Symbol
MGI: Mir337
Description
Mus musculus mmu-mir-337 precursor miRNA mir-337
Gene
family?
RF00765; mir-337

Literature search
16 open access papers mention mmu-mir-337
(58 sentences)

Sequence

26742 reads, 388 reads per million, 90 experiments
caguguagugagaaguuggggggugggaaCGGCGUCAUGCAGGAGUUGAUUgcacagccauUCAGCUCCUAUAUGAUGCCUUUcuucacccccuuca
.................((((((((((((.(((((((((.(((((((((.((......)).))))))))).))))))))).))).)))))))))...

Structure
caguguagugagaaguu         -   C         C         U  ca 
                 ggggggugg gaa GGCGUCAUG AGGAGUUGA Ug  c
                 ||||||||| ||| ||||||||| ||||||||| ||   
                 ucccccacu cUU CCGUAGUAU UCCUCGACU ac  a
--------------acu         u   U         A         u  cg 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000614). Seitz et al. later predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the hairpin, named here miR-337-5p and miR-337-3p [3].

Genome context
chr12: 109585789-109585885 [+]
Clustered miRNAs
13 other miRNAs are < 10 kb from mmu-mir-337
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-337-5p

Accession MIMAT0004644
Description Mus musculus mmu-miR-337-5p mature miRNA
Sequence 30 - CGGCGUCAUGCAGGAGUUGAUU - 51
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-337-3p

Accession MIMAT0000578
Description Mus musculus mmu-miR-337-3p mature miRNA
Sequence 62 - UCAGCUCCUAUAUGAUGCCUUU - 83
Evidence experimental
PCR [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365