miRBase entry: rno-mir-324

Stem-loop rno-mir-324


Accession
MI0000594
Description
Rattus norvegicus rno-mir-324 precursor miRNA

Literature search
22 open access papers mention rno-mir-324
(73 sentences)

Sequence

31381 reads, 28 reads per million, 482 experiments
cugacuaugccuccuCGCAUCCCCUAGGGCAUUGGUGUaaagcuggagacCCACUGCCCCAGGUGCUGCUGGggguuguaguc
..((((((((((((..(((.(.(((.(((((.(((.((..........))))).))))).))).).))).))))).)))))))

Structure
cu       -     uC   U C   A     U   U  aaag 
  gacuaug ccucc  GCA C CCU GGGCA UGG GU    c
  ||||||| |||||  ||| | ||| ||||| ||| ||     
  cugaugu gggGG  CGU G GGA CCCGU ACC ca    u
--       u     -U   C U   C     C   -  gagg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 56621126-56621208 [+]

Database links

Mature rno-miR-324-5p

Accession MIMAT0000553
Description Rattus norvegicus rno-miR-324-5p mature miRNA
Sequence 16 - CGCAUCCCCUAGGGCAUUGGUGU - 38
Evidence experimental
cloned [1-2,4], Northern [1], SOLiD [5]

Mature rno-miR-324-3p

Accession MIMAT0000554
Description Rattus norvegicus rno-miR-324-3p mature miRNA
Sequence 51 - CCACUGCCCCAGGUGCUGCUGG - 72
Evidence experimental
cloned [1,3], Northern [1,3], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68