miRBase entry: mmu-mir-323

Stem-loop mmu-mir-323


Accession
MI0000592
Symbol
MGI: Mir323
Description
Mus musculus mmu-mir-323 precursor miRNA

Literature search
13 open access papers mention mmu-mir-323
(19 sentences)

Sequence

20668 reads, 389 reads per million, 81 experiments
uugguacuuggagagAGGUGGUCCGUGGCGCGUUCGCuucauuuauggcgCACAUUACACGGUCGACCUCUuugcgguaucuaauc
..((((((.(.((((((((.(.(((((..(.((.((((........)))).)).)..))))).).)))))))).))))))).....

Structure
---uu      u g        G U     GC C  U    uca 
     gguacu g agagAGGU G CCGUG  G GU CGCu   u
     |||||| | |||||||| | |||||  | || ||||    
     cuaugg c uuUCUCCA C GGCAC  U CA gcgg   u
cuaau      - g        G U     AU A  C    uau 


Annotation confidence High
Do you think this miRNA is real?
Comments
Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons [1]. This mouse miRNA is predicted based on homology to the verified rat sequence (MIR:MI0000591). Seitz et al. independently predicted the miRNA hairpin precursor sequence by conservation between mouse and human [2]. Landgraf et al. later cloned and sequenced mature products from both arms of the predicted hairpin [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr12: 109712508-109712593 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from mmu-mir-323
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-323-5p

Accession MIMAT0004638
Description Mus musculus mmu-miR-323-5p mature miRNA
Sequence 16 - AGGUGGUCCGUGGCGCGUUCGC - 37
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-323-3p

Accession MIMAT0000551
Description Mus musculus mmu-miR-323-3p mature miRNA
Sequence 51 - CACAUUACACGGUCGACCUCU - 71
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365