Stem-loop mmu-mir-103-1

Accession

MI0000587

Symbol

MGI: Mir103-1

Description

Mus musculus mmu-mir-103-1 precursor miRNA mir-103

Gene
family

RF00129; mir-103

Literature search

99 open access papers mention mmu-mir-103-1
(437 sentences)

Sequence

6142774 reads, 16701 reads per million, 107 experiments

uucuuacugcccucGGCUUCUUUACAGUGCUGCCUUGuugcauauggaucaAGCAGCAUUGUACAGGGCUAUGAaggcauugagac
.(((((.((((.((((((.((.(((((((((((.(((.(.(....).).)))))))))))))).))))))..)).)))).))))).

Structure

u     c    c  --    U  U           C   u g a 
 ucuua ugcc uc  GGCU CU UACAGUGCUGC UUG u c u
 ||||| |||| ||  |||| || ||||||||||| ||| | |  
 agagu acgg AG  UCGG GA AUGUUACGACG Aac a g a
c     u    a  UA    -  C           -   u g u 

Annotation confidence High

Comments

This miRNA sequence was predicted based on homology to a verified miRNA from human [1], and subsequently verified by cloning [2-4].

Genome context

chr11: 35782396-35782481 [+]

Mature mmu-miR-103-1-5p

• Accession: MIMAT0017024
• Description: Mus musculus mmu-miR-103-1-5p mature miRNA
• Sequence: 15 - GGCUUCUUUACAGUGCUGCCUUG - 37
• Evidence: experimental ; 454 [6], Illumina [7]

Mature mmu-miR-103-3p

• Accession: MIMAT0000546
• Description: Mus musculus mmu-miR-103-3p mature miRNA
• Sequence: 52 - AGCAGCAUUGUACAGGGCUAUGA - 74
• Evidence: experimental ; cloned [2-4], Illumina [5,7]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 11914277
   miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
   "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
   "Genes Dev (2002) 16:720-728


4. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


7. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275