Stem-loop mmu-mir-129-2

Accession

MI0000585

Symbol

MGI: Mir129-2

Description

Mus musculus mmu-mir-129-2 precursor miRNA

Literature search

58 open access papers mention mmu-mir-129-2
(616 sentences)

Sequence

176826 reads, 245 reads per million, 101 experiments

ugccuuucgcgaauCUUUUUGCGGUCUGGGCUUGCuguacauaacucaauagccggAAGCCCUUACCCCAAAAAGCAUucgcggagggcg
.((((((((((((((((((((.(((..(((((((((((..........)))))...))))))..))).))))))).))))))))))))).

Structure

u             -       C   CU      ---     acau 
 gccuuucgcgaau CUUUUUG GGU  GGGCUU   GCugu    a
 ||||||||||||| ||||||| |||  ||||||   |||||     
 cgggaggcgcuUA GAAAAAC CCA  CCCGAA   cgaua    a
g             C       C   UU      ggc     acuc 

Annotation confidence High

Comments

The miRNA from the 5' arm of this precursor was verified by cloning in mouse [1]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both mouse (this entry and MIR:MI0000222) and human (MIR:MI0000252 and MIR:MI0000473). Poy et al. independently cloned a mature miRNA from the 3' arm of the precursor, called mmu-miR-129-3p [3]. This sequence is not perfectly conserved in the other predicted mouse miR-129 precursor (MIR:MI0000222). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr2: 94241364-94241453 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-129-2

Mature mmu-miR-129-5p

• Accession: MIMAT0000209
• Description: Mus musculus mmu-miR-129-5p mature miRNA
• Sequence: 15 - CUUUUUGCGGUCUGGGCUUGC - 35
• Evidence: experimental ; cloned [1,3-4], Illumina [5-6]

Mature mmu-miR-129-2-3p

• Accession: MIMAT0000544
• Description: Mus musculus mmu-miR-129-2-3p mature miRNA
• Sequence: 57 - AAGCCCUUACCCCAAAAAGCAU - 78
• Evidence: experimental ; cloned [3-4], Illumina [5-6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


4. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009