miRBase entry: mmu-mir-29a

Stem-loop mmu-mir-29a


Accession
MI0000576
Symbol
MGI: Mir29a
Description
Mus musculus mmu-mir-29a precursor miRNA

Literature search
329 open access papers mention mmu-mir-29a
(2917 sentences)

Sequence

3527611 reads, 13408 reads per million, 107 experiments
accccuuagaggaugACUGAUUUCUUUUGGUGUUCAGagucaauagaauuuucUAGCACCAUCUGAAAUCGGUUAuaaugauugggga
.((((....(..((((((((((((...(((((((.((((...........)))))))))))...))))))))))))..)....)))).

Structure
a    uuag gg            UUU       C    ucaa 
 cccc    a  augACUGAUUUC   UGGUGUU AGag    u
 ||||    |  ||||||||||||   ||||||| ||||    a
 gggg    u  uAUUGGCUAAAG   ACCACGA Ucuu    g
a    uuag aa            UCU       -    uuaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5].

Genome context
chr6: 31062660-31062747 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-29a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-29a-5p

Accession MIMAT0004631
Description Mus musculus mmu-miR-29a-5p mature miRNA
Sequence 16 - ACUGAUUUCUUUUGGUGUUCAG - 37
Evidence experimental
cloned [5], Illumina [6-7]
Database links
Predicted targets

Mature mmu-miR-29a-3p

Accession MIMAT0000535
Description Mus musculus mmu-miR-29a-3p mature miRNA
Sequence 54 - UAGCACCAUCUGAAAUCGGUUA - 75
Evidence experimental
cloned [1,3-5], Northern [2], Illumina [6-7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009