Stem-loop mmu-mir-26b

Accession

MI0000575

Symbol

MGI: Mir26b

Description

Mus musculus mmu-mir-26b precursor miRNA mir-26

Gene
family

RF00244; mir-26

Literature search

102 open access papers mention mmu-mir-26b
(549 sentences)

Sequence

762996 reads, 2699 reads per million, 107 experiments

ugcccgggacccagUUCAAGUAAUUCAGGAUAGGUuguggugcugaccagCCUGUUCUCCAUUACUUGGCUCgggggccggugcc
.((((((..((((((.((((((((..(((((((((..((((....)))))))))))))..))))))))))).)))..)))).)).

Structure

u  -    ga   -   U        UC         ug    g 
 gc ccgg  ccc agU CAAGUAAU  AGGAUAGGU  uggu c
 || ||||  ||| ||| ||||||||  |||||||||  ||||  
 cg ggcc  ggg UCG GUUCAUUA  UCUUGUCCg  acca u
c  u    gg   C   -        CC         --    g 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context

chr1: 74394310-74394394 [+]

Mature mmu-miR-26b-5p

• Accession: MIMAT0000534
• Description: Mus musculus mmu-miR-26b-5p mature miRNA
• Sequence: 15 - UUCAAGUAAUUCAGGAUAGGU - 35
• Evidence: experimental ; cloned [1-2,4-6], Northern [2], Illumina [7]

Mature mmu-miR-26b-3p

• Accession: MIMAT0004630
• Description: Mus musculus mmu-miR-26b-3p mature miRNA
• Sequence: 51 - CCUGUUCUCCAUUACUUGGCUC - 72
• Evidence: experimental ; cloned [6], Illumina [7-8]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


4. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


5. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


6. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


7. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


8. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009