Stem-loop mmu-let-7f-2

Accession

MI0000563

Symbol

MGI: Mirlet7f-2

Description

Mus musculus mmu-let-7f-2 precursor miRNA

Literature search

421 open access papers mention mmu-let-7f-2
(2215 sentences)

Sequence

48116143 reads, 108671 reads per million, 107 experiments

ugugggaUGAGGUAGUAGAUUGUAUAGUUuuagggucauaccccaucuuggagauaaCUAUACAGUCUACUGUCUUUCccacg
.((((((.((((((((((((((((((((((((((((........))))))))....)))))))))))))))))))))))))).

Structure

u      U                    ----        cau 
 guggga GAGGUAGUAGAUUGUAUAGU    Uuuagggu   a
 |||||| ||||||||||||||||||||    ||||||||    
 caccCU UUCUGUCAUCUGACAUAUCa    agguucua   c
g      -                    auag        ccc 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chrX: 151912346-151912428 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-let-7f-2

Mature mmu-let-7f-5p

• Accession: MIMAT0000525
• Description: Mus musculus mmu-let-7f-5p mature miRNA
• Sequence: 8 - UGAGGUAGUAGAUUGUAUAGUU - 29
• Evidence: experimental ; cloned [1-4], Illumina [5,7]

Mature mmu-let-7f-2-3p

• Accession: MIMAT0017017
• Description: Mus musculus mmu-let-7f-2-3p mature miRNA
• Sequence: 58 - CUAUACAGUCUACUGUCUUUC - 78
• Evidence: experimental ; 454 [6], Illumina [7]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


5. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


6. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


7. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275