miRBase entry: mmu-mir-196a-2

Stem-loop mmu-mir-196a-2


Accession
MI0000553
Symbol
MGI: Mir196a-2
Description
Mus musculus mmu-mir-196a-2 precursor miRNA

Literature search
66 open access papers mention mmu-mir-196a-2
(595 sentences)

Sequence

197449 reads, 293 reads per million, 73 experiments
agcugaucuguggcuUAGGUAGUUUCAUGUUGUUGGGauugaguuuugaacUCGGCAACAAGAAACUGCCUGAguuacaucaguc
.(((((..((((((((((((((((((.((((((((((.((........)))))))))))).))))))))))))))))))))))).

Structure
a     uc                  A          a  gag 
 gcuga  uguggcuUAGGUAGUUUC UGUUGUUGGG uu   u
 |||||  |||||||||||||||||| |||||||||| ||    
 ugacu  acauugAGUCCGUCAAAG ACAACGGCUc aa   u
c     --                  A          -  guu 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr15: 102973350-102973434 [+]

Database links

Mature mmu-miR-196a-5p

Accession MIMAT0000518
Description Mus musculus mmu-miR-196a-5p mature miRNA
Sequence 16 - UAGGUAGUUUCAUGUUGUUGGG - 37
Evidence experimental
cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-196a-2-3p

Accession MIMAT0004618
Description Mus musculus mmu-miR-196a-2-3p mature miRNA
Sequence 52 - UCGGCAACAAGAAACUGCCUGA - 73
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  5. PubMed ID: 15105502
    MicroRNA-directed cleavage of HOXB8 mRNA
    "Yekta S, Shih IH, Bartel DP"
    "Science (2004) 304:594-596