Stem-loop mmu-mir-30d

Accession

MI0000549

Symbol

MGI: Mir30d

Description

Mus musculus mmu-mir-30d precursor miRNA

Literature search

194 open access papers mention mmu-mir-30d
(1093 sentences)

Sequence

2731826 reads, 4620 reads per million, 107 experiments

aagucugugucUGUAAACAUCCCCGACUGGAAGcuguaagccacagccaagCUUUCAGUCAGAUGUUUGCUGCuacuggcuc
.((((.(((.(.(((((((((...(((((((((((....((....))..))))))))))).))))))))).).))).)))).

Structure

a    u   u U         CCC           guaa  c 
 aguc gug c GUAAACAUC   GACUGGAAGcu    gc a
 |||| ||| | |||||||||   |||||||||||    ||  
 ucgg cau G CGUUUGUAG   CUGACUUUCga    cg c
c    u   C U         --A           --ac  a 

Annotation confidence High

Genome context

chr15: 68341208-68341289 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from mmu-mir-30d

Mature mmu-miR-30d-5p

• Accession: MIMAT0000515
• Description: Mus musculus mmu-miR-30d-5p mature miRNA
• Sequence: 12 - UGUAAACAUCCCCGACUGGAAG - 33
• Evidence: experimental ; cloned [1,3-5], Illumina [6,8]

Mature mmu-miR-30d-3p

• Accession: MIMAT0017011
• Description: Mus musculus mmu-miR-30d-3p mature miRNA
• Sequence: 52 - CUUUCAGUCAGAUGUUUGCUGC - 73
• Evidence: experimental ; 454 [7], Illumina [8]

References

1. PubMed ID: 12554860
   Numerous microRNPs in neuronal cells containing novel microRNAs
   "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
   "RNA (2003) 9:180-186


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


4. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


5. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


6. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


7. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


8. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275