miRBase entry: mmu-mir-19b-2

Stem-loop mmu-mir-19b-2


Accession
MI0000546
Symbol
MGI: Mir19b-2
Description
Mus musculus mmu-mir-19b-2 precursor miRNA mir-19
Gene
family?
RF00245; mir-19

Literature search
124 open access papers mention mmu-mir-19b-2
(755 sentences)

Sequence

232540 reads, 2008 reads per million, 107 experiments
acuuacgauuAGUUUUGCAGAUUUGCAGUUCAGCguauaugugaauauauggcUGUGCAAAUCCAUGCAAAACUGAuuguggga
.((((((((((((((((((((((((((...((((((((((....)))))).))))))))))))..)))))))))))))))))).

Structure
a                  --        GUU    -      g 
 cuuacgauuAGUUUUGCA  GAUUUGCA   CAGC guauau u
 ||||||||||||||||||  ||||||||   |||| ||||||  
 ggguguuAGUCAAAACGU  CUAAACGU   GUcg uauaua g
a                  AC        ---    g      a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mouse miR-19b was cloned from mouse tissues by independent groups [1,2]. There are two predicted hairpin precursors, with closely related human homologues [4]: mir-19b-1 (MIR:MI0000718) on chromosome 14, and mir-19b-2 (previously named mir-19b here, MIR:MI0000546) on mouse chromosome X.

Genome context
chrX: 52741983-52742066 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from mmu-mir-19b-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-19b-2-5p

Accession MIMAT0017010
Description Mus musculus mmu-miR-19b-2-5p mature miRNA
Sequence 11 - AGUUUUGCAGAUUUGCAGUUCAGC - 34
Evidence experimental
Illumina [7]

Mature mmu-miR-19b-3p

Accession MIMAT0000513
Description Mus musculus mmu-miR-19b-3p mature miRNA
Sequence 54 - UGUGCAAAUCCAUGCAAAACUGA - 76
Evidence experimental
cloned [1-3,5], Northern [2], Illumina [6,8]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  7. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73