miRBase entry: dme-mir-2c

Stem-loop dme-mir-2c


Accession
MI0000431
Description
Drosophila melanogaster dme-mir-2c precursor miRNA

Literature search
28 open access papers mention dme-mir-2c
(104 sentences)

Sequence

81091 reads, 1940 reads per million, 49 experiments
ucguaucuuacuuucaaugUCAUCAAAAAGGGCUGAAGAAAGAUauuucugcauuugaaucgUAUCACAGCCAGCUUUGAUGGGCauugcaaugagcagcga
((((..((((.((.(((((((((((((...(((((......((((((((.......)))..))))).)))))...)))))).))))))).))))))..))))

Structure
    au    c  u       -      AAG     AAGAAA     --   ug 
ucgu  cuua uu caaugUC AUCAAA   GGCUG      GAUau  uuc  c
||||  |||| || ||||||| ||||||   |||||      |||||  |||  a
agcg  gagu aa guuaCGG UAGUUU   CCGAC      CUAUg  aag  u
    ac    -  c       G      CGA     -----A     cu   uu 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-2c was predicted by similarity to miR-2a (MIR:MI0000117). Expression in Drosophila was independently confirmed by Northern blot analysis [1] and by cloning [2]. The latter study confirmed the ends of the excised miR. Stark et al. [3] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
chr3R: 15417744-15417845 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from dme-mir-2c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-2c-3p

Accession MIMAT0000411
Description Drosophila melanogaster dme-miR-2c-3p mature miRNA
Sequence 63 - UAUCACAGCCAGCUUUGAUGGGC - 85
Evidence experimental
Northern [1], cloned [2], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature dme-miR-2c-5p

Accession MIMAT0020845
Description Drosophila melanogaster dme-miR-2c-5p mature miRNA
Sequence 20 - UCAUCAAAAAGGGCUGAAGAAAGAU - 44
Evidence not_experimental
Database links

References

  1. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  2. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  3. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  4. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  5. PubMed ID: 14691535
    Identification of Drosophila MicroRNA targets
    "Stark A, Brennecke J, Russell RB, Cohen SM"
    "PLoS Biol (2003) 1:E60