miRBase entry: dme-mir-313

Stem-loop dme-mir-313


Accession
MI0000425
Description
Drosophila melanogaster dme-mir-313 precursor miRNA mir-310
Gene
family?
RF04249; mir-310

Literature search
6 open access papers mention dme-mir-313
(19 sentences)

Sequence

10808 reads, 661 reads per million, 47 experiments
auuuucUGCUGCGGAUGGGGGCAGUACUguuuuuuuaacauugagUAUUGCACUUUUCACAGCCCGAaaau
((((((.((((.(((.((..((((((((...............)))))))).)).))).))))..))))))

Structure
      -U    C   U  GG        guuuuu 
auuuuc  GCUG GGA GG  GCAGUACU      u
||||||  |||| ||| ||  ||||||||      u
uaaaAG  CGAC CUU UC  CGUUAUga      a
      CC    A   U  -A        guuaca 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-313 was predicted based on conservation of clustering with miR-310 (MIR:MI0000422), miR-311 (MIR:MI0000423) and miR-312 (MIR:MI0000424). Its expression has not been verified.

Genome context
chr2R: 20584190-20584260 [-]
Clustered miRNAs
6 other miRNAs are < 10 kb from dme-mir-313
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-313-3p

Accession MIMAT0000405
Description Drosophila melanogaster dme-miR-313-3p mature miRNA
Sequence 46 - UAUUGCACUUUUCACAGCCCGA - 67
Evidence experimental
454 [2-3], Illumina [3]
Database links
Predicted targets

Mature dme-miR-313-5p

Accession MIMAT0020839
Description Drosophila melanogaster dme-miR-313-5p mature miRNA
Sequence 7 - UGCUGCGGAUGGGGGCAGUACU - 28
Evidence not_experimental
Database links

References

  1. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  2. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  3. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879