miRBase entry: mmu-mir-34c

Stem-loop mmu-mir-34c


Accession
MI0000403
Symbol
MGI: Mir34c
Description
Mus musculus mmu-mir-34c precursor miRNA mir-34
Gene
family?
RF00456; mir-34

Literature search
228 open access papers mention mmu-mir-34c
(1443 sentences)

Sequence

5659980 reads, 29244 reads per million, 106 experiments
agucuaguuacuAGGCAGUGUAGUUAGCUGAUUGCuaauaguaccAAUCACUAACCACACAGCCAGGuaaaaagacu
(((((..(((((.(((.((((.(((((.((((((.((....)).))))))))))).)))).))).)))))..)))))

Structure
     ag     A   A    A     C      C  a 
agucu  uuacu GGC GUGU GUUAG UGAUUG ua u
|||||  ||||| ||| |||| ||||| |||||| ||  
ucaga  aauGG CCG CACA CAAUC ACUAAc au a
     aa     A   A    C     -      c  g 


Annotation confidence High
Do you think this miRNA is real?
Comments
Houbaviy et al. cloned 3 closely related sequences from mouse embryonic stem cells [1], and named them miR-34a, miR-34b and miR-172. These names have been remapped to miR-34c (MIR:MI0000403), miR-34b (MIR:MI0000404) and miR-34a (MIR:MI0000584) to clarify homology with human sequences.

Genome context
chr9: 51103034-51103110 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-34c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-34c-5p

Accession MIMAT0000381
Description Mus musculus mmu-miR-34c-5p mature miRNA
Sequence 13 - AGGCAGUGUAGUUAGCUGAUUGC - 35
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-34c-3p

Accession MIMAT0004580
Description Mus musculus mmu-miR-34c-3p mature miRNA
Sequence 46 - AAUCACUAACCACACAGCCAGG - 67
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009