miRBase entry: dme-mir-100

Stem-loop dme-mir-100


Accession
MI0000378
Description
Drosophila melanogaster dme-mir-100 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Dme-mir-100 is a mature microRNA in Drosophila melanogaster, with the "dme" prefix indicating the organism and "mir-100" being a sequentially assigned number [PMC4718083]. It is part of a microRNA gene naming convention, with dme-mir-100 and dme-mir-100* representing the guide and passenger strands, respectively [PMC3965103]. This microRNA has been selected for study due to its orthology with human miRNAs and its relevance in laboratory data [PMC5090246]. Dme-mir-100 shares extensive overall similarity with human miRNAs hsa-miR-10a and hsa-miR-10b, despite some mismatches at the 5′ end [PMC2486268]. The expression of dme-mir-100 is subject to complex post-transcriptional regulation, as evidenced by its low correlation coefficients when compared to other miRNAs* in expression profiles [PMC3150300]. Additionally, tissue-specific A-to-I editing has been observed for dme-mir-100 in male heads and Kc167 cell line, indicating a level of regulation during its maturation process [PMC3150300]. The correlation analysis within the 100~125 cluster suggests intricate regulatory interactions involving dme-mir-125 and dme-let-7 as well as post-transcriptional modifications like A-to-I editing being potential regulatory mechanisms for dme-mir-100 [PMC3150300]. This microRNA has also been implicated in metamorphosis development in Drosophila melanogaster alongside other miRNAs such as Dme-let7 and Dme-miR125 [PMC5689003].

Literature search
18 open access papers mention dme-mir-100
(82 sentences)

Sequence

10859 reads, 245 reads per million, 46 experiments
ccauuaacagaAACCCGUAAAUCCGAACUUGUGcuguuuuauaucuguuaCAAGACCGGCAUUAUGGGAGUCugucaaugcaaacaacugguuuuuggca
.((((.(((((..(((((((..(((..(((((((.(........).).))))))..)))..)))))))..))))).))))....................

Structure
-------------------c    a     AA       AU   AA      - u uuu 
                    cauu acaga  CCCGUAA  CCG  CUUGUG c g   u
                    |||| |||||  |||||||  |||  |||||| | |    
                    guaa uguCU  GGGUAUU  GGC  GAACau g c   a
acgguuuuuggucaacaaac    c     GA       AC   CA      u u uau 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-100 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.

Genome context
chr2L: 18471434-18471533 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from dme-mir-100
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-100-5p

Accession MIMAT0000357
Description Drosophila melanogaster dme-miR-100-5p mature miRNA
Sequence 12 - AACCCGUAAAUCCGAACUUGUG - 33
Evidence experimental
Northern [1,3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature dme-miR-100-3p

Accession MIMAT0020818
Description Drosophila melanogaster dme-miR-100-3p mature miRNA
Sequence 51 - CAAGACCGGCAUUAUGGGAGUC - 72
Evidence not_experimental
Database links

References

  1. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  2. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  3. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  4. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  5. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42