miRBase entry: dme-mir-124

Stem-loop dme-mir-124


Accession
MI0000373
Description
Drosophila melanogaster dme-mir-124 precursor miRNA

Literature search
19 open access papers mention dme-mir-124
(339 sentences)

Sequence

295929 reads, 18560 reads per million, 48 experiments
ucauuugguacguuuuucuccuGGUAUCCACUGUAGGCCUAUAUGuauuuccaccaUAAGGCACGCGGUGAAUGCCAAGagcgaacgcaguucuacaaau
..........(((((..(((.((((((.((((((..((((.((((.........))))))))..)))))).)))))).))).))))).............

Structure
---ucauuuggua     uu   c      C      AG    A    uau 
             cguuu  cuc uGGUAU CACUGU  GCCU UAUG   u
             |||||  ||| |||||| ||||||  |||| ||||   u
             gcaag  gaG ACCGUA GUGGCG  CGGA AUac   c
uaaacaucuugac     -c   A      A      CA    -    cac 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-124 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 19-23 nt with 23 nt the most commonly expressed.

Genome context
chr2L: 17566370-17566469 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from dme-mir-124
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-124-3p

Accession MIMAT0000351
Description Drosophila melanogaster dme-miR-124-3p mature miRNA
Sequence 57 - UAAGGCACGCGGUGAAUGCCAAG - 79
Evidence experimental
cloned [2], Northern [2-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature dme-miR-124-5p

Accession MIMAT0020813
Description Drosophila melanogaster dme-miR-124-5p mature miRNA
Sequence 23 - GGUAUCCACUGUAGGCCUAUAUG - 45
Evidence not_experimental
Database links

References

  1. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  2. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  3. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  4. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  5. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42