Dme-mir-283, a highly conserved host microRNA in Drosophila, is significantly upregulated in response to alphavirus infection and is predicted to target the 3′UTR of the DmDNMT2 gene [PMC8402854]. This upregulation aligns with the observed SINV-responsive expression pattern of dme-mir-283 and its target [PMC8402854]. Despite its response to viral infection, dme-mir-283 shows a lack of correlation with the expression profiles of other miRNAs in its cluster, such as dme-mir-304 and dme-mir-12, as well as with its own star form, dme-mir-283* [PMC3150300]. This suggests a distinct regulatory role for dme-mir-283 that is not shared with closely related miRNAs within its cluster [PMC3150300].
cucacac uc AA U agcuaagccu gauuc aaaggu AUAUCAGCUGG AAUUCUGGg a ||||| |||||| ||||||||||| ||||||||| uuaag uuuucA UAUGGUUGACU UUAAGGCuc a ------- uu GC - acaaaguaua
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000347 |
Description | Drosophila melanogaster dme-miR-283-5p mature miRNA |
Sequence | 21 - AAAUAUCAGCUGGUAAUUCUGG - 42 |
Evidence |
experimental
Northern [1-2], 454 [3-4], Illumina [4] |
Database links |
![]() |
Predicted targets |
![]() |
Accession | MIMAT0020810 |
Description | Drosophila melanogaster dme-miR-283-3p mature miRNA |
Sequence | 68 - CGGAAUUUCAGUUGGUAUCGA - 88 |
Evidence | not_experimental |
Database links |
![]() |
|