miRBase entry: dme-mir-283

Stem-loop dme-mir-283


Accession
MI0000368
Description
Drosophila melanogaster dme-mir-283 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Dme-mir-283, a highly conserved host microRNA in Drosophila, is significantly upregulated in response to alphavirus infection and is predicted to target the 3′UTR of the DmDNMT2 gene [PMC8402854]. This upregulation aligns with the observed SINV-responsive expression pattern of dme-mir-283 and its target [PMC8402854]. Despite its response to viral infection, dme-mir-283 shows a lack of correlation with the expression profiles of other miRNAs in its cluster, such as dme-mir-304 and dme-mir-12, as well as with its own star form, dme-mir-283* [PMC3150300]. This suggests a distinct regulatory role for dme-mir-283 that is not shared with closely related miRNAs within its cluster [PMC3150300].

Literature search
9 open access papers mention dme-mir-283
(17 sentences)

Sequence

395574 reads, 1989 reads per million, 49 experiments
cucacacgauucucaaagguAAAUAUCAGCUGGUAAUUCUGGgagcuaagccuaaauaugaaacacuCGGAAUUUCAGUUGGUAUCGAcuuuuuugaauu
.......(((((..((((((..(((((((((((.(((((((((......................))))))))))))))))))))..))))))..)))))

Structure
cucacac     uc      AA           U         agcuaagccu 
       gauuc  aaaggu  AUAUCAGCUGG AAUUCUGGg          a
       |||||  ||||||  ||||||||||| |||||||||           
       uuaag  uuuucA  UAUGGUUGACU UUAAGGCuc          a
-------     uu      GC           -         acaaaguaua 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 15507956-15508055 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from dme-mir-283
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-283-5p

Accession MIMAT0000347
Description Drosophila melanogaster dme-miR-283-5p mature miRNA
Sequence 21 - AAAUAUCAGCUGGUAAUUCUGG - 42
Evidence experimental
Northern [1-2], 454 [3-4], Illumina [4]
Database links
Predicted targets

Mature dme-miR-283-3p

Accession MIMAT0020810
Description Drosophila melanogaster dme-miR-283-3p mature miRNA
Sequence 68 - CGGAAUUUCAGUUGGUAUCGA - 88
Evidence not_experimental
Database links

References

  1. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  2. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  3. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  4. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42