miRBase entry: dme-mir-92a

Stem-loop dme-mir-92a


Accession
MI0000357
Description
Drosophila melanogaster dme-mir-92a precursor miRNA

Literature search
25 open access papers mention dme-mir-92a
(396 sentences)

Sequence

163316 reads, 5725 reads per million, 49 experiments
aauaugaauuucccguAGGACGGGAAGGUGUCAACGUUuugcauuucgaauaaaCAUUGCACUUGUCCCGGCCUAUgggcgguuuguaauaaaca
..((((((((.((((((((.((((((((((.(((.((((............)))).)))))))).))))).)))))))).)))))))).......

Structure
-----aa        u        A     -     U   C    ugcau 
       uaugaauu cccguAGG CGGGA AGGUG CAA GUUu     u
       |||||||| |||||||| ||||| ||||| ||| ||||      
       auguuugg gggUAUCC GCCCU UUCAC GUU Caaa     u
acaaaua        c        G     G     -   A    uaagc 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-92a was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the 5' end of the excised miRNA by cloning and reported a length distribution of 22-25 nt with 22 nt the most commonly expressed.

Genome context
chr3R: 25646506-25646600 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from dme-mir-92a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-92a-3p

Accession MIMAT0000334
Description Drosophila melanogaster dme-miR-92a-3p mature miRNA
Sequence 55 - CAUUGCACUUGUCCCGGCCUAU - 76
Evidence experimental
cloned [2], Northern [3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature dme-miR-92a-5p

Accession MIMAT0020802
Description Drosophila melanogaster dme-miR-92a-5p mature miRNA
Sequence 17 - AGGACGGGAAGGUGUCAACGUU - 38
Evidence not_experimental
Database links

References

  1. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  2. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  3. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  4. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  5. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42