mmu-mir-206 is a microRNA identified in mice, analogous to hsa-miR-206 in humans, and is involved in the regulation of gene expression [PMC4383946]. It has been observed that the expression of mmu-mir-206, along with other microRNAs such as mmu-miR-1 and mmu-miR-133a, can be positively influenced by IGF1 treatment when combined with MAPK/ERK inhibitor treatment [PMC4325962]. The regulation of mmu-mir-206 appears to be transcriptional as both precursor and mature forms are similarly affected [PMC4325962]. The expression of this microRNA is also sensitive to other factors; for instance, Rb1 markedly inhibits the transcripts of mmu-mir-206 among other microRNAs [PMC9120625]. Additionally, mmu-mir-206 has been associated with transcription factors such as NF-γ after orchiectomy in mice [PMC7074395], and its expression increases progressively during embryonic development [PMC1635289]. In muscle cell differentiation studies involving C2C12 cells, mmu-mir-206 was identified as one of the upregulated microRNAs [PMC3753644], and its locus has been mapped to chromosome 1 in mice [PMC2064500]. The expression levels of this miRNA vary with age in muscle tissue; for instance, it was upregulated during late testing (LT) periods compared to other time points such as short term (ST) or intermediate term (IT) testing periods where different miRNAs were downregulated [PMC3030602]. Experimental manipulation can also alter levels of mmu-mir-206 through transfection with inhibitors or overexpression constructs coupled with GFP [PMC3973319], highlighting its functional significance and potential for targeted research.
- C U auau ccagg ccACAUGCUUCUUUAUAU C CAUAg c ||||| |||||||||||||||||| | ||||| u gguuu GGUGUGUGAAGGAAUGUA G GUauc c u A - acga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0017004 |
Description | Mus musculus mmu-miR-206-5p mature miRNA |
Sequence | 8 - ACAUGCUUCUUUAUAUCCUCAUA - 30 |
Evidence |
experimental
Illumina [4] |
Accession | MIMAT0000239 |
Description | Mus musculus mmu-miR-206-3p mature miRNA |
Sequence | 46 - UGGAAUGUAAGGAAGUGUGUGG - 67 |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|