miRBase entry: ath-MIR168a

Stem-loop ath-MIR168a


Accession
MI0000210
Description
Arabidopsis thaliana ath-MIR168a precursor miRNA

Literature search
29 open access papers mention ath-MIR168a
(85 sentences)

Sequence


caccaucgggcucggauUCGCUUGGUGCAGGUCGGGAAccaauucggcugacacagccucgugacuuuuaaaccuuuauugguuugugagcagggauuggauCCCGCCUUGCAUCAACUGAAUcggauccucgaggug
((((.(((((.((.((((((.((((((((((.(((((.((((((((((((...)))))...((.(((.((((((......)))))).))))).))))))).))))).)))))))))).)))))).)).)).)))))))

Structure
    a   -  c  g      C          U     A       ggcugacacagccucg  a   u      uu 
cacc ucg gg uc gauUCG UUGGUGCAGG CGGGA ccaauuc                ug cuu uaaacc  u
|||| ||| || || |||||| |||||||||| ||||| |||||||                || ||| ||||||   
gugg agc cc ag cUAAGU AACUACGUUC GCCCu gguuagg                ac gag guuugg  a
    -   u  u  g      C          C     a       ---------------g  -   u      uu 


Annotation confidence Low
Do you think this miRNA is real?
Comments
MIR168a thought to target mRNAs coding for Argonaute (AGO1), which is required for axillary shoot meristem formation and leaf development in Arabidopsis. It has been suggested that AGO1 may also influence miRNA accumulation in plants and that miR168 may act as a negative-feedback mechanism for controlling expression of the AGO1 gene [2].

Genome context
chr4: 10578635-10578772 [+]

Database links

Mature ath-miR168a-5p

Accession MIMAT0000198
Description Arabidopsis thaliana ath-miR168a-5p mature miRNA
Sequence 18 - UCGCUUGGUGCAGGUCGGGAA - 38
Evidence experimental
cloned [1,3], Northern [1], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR168a-3p

Accession MIMAT0031884
Description Arabidopsis thaliana ath-miR168a-3p mature miRNA
Sequence 103 - CCCGCCUUGCAUCAACUGAAU - 123
Evidence not_experimental

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  4. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  5. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  6. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177