miRBase entry: ath-MIR167a

Stem-loop ath-MIR167a


Accession
MI0000208
Description
Arabidopsis thaliana ath-MIR167a precursor miRNA

Literature search
44 open access papers mention ath-MIR167a
(284 sentences)

Sequence


uggugcaccggcaucugaUGAAGCUGCCAGCAUGAUCUAauuagcuuucuuuauccuuuguuguguuucaugacgaugguuaagagaucagucucgauuaGAUCAUGUUCGCAGUUUCACCcguugacugucgcaccc
.(((((..(((((.(.(.(((((((((.((((((((((((((((((.(((((..((.((((((((...)))))))).))...)))))..)).)).)))))))))))))).))))))))).).).)).)))..))))).

Structure
u     ac   -  u u a         C              -  -  -u     -au  u        u 
 ggugc  cgg ca c g UGAAGCUGC AGCAUGAUCUAauu ag cu  ucuuu   cc uuguugug  
 |||||  ||| || | | ||||||||| |||||||||||||| || ||  |||||   || |||||||| u
 ccacg  guc gu g C ACUUUGACG UUGUACUAGauuag uc ga  agaga   gg agcaguac  
c     cu   a  u c C         C              c  u  cu     auu  u        u 


Annotation confidence Low
Do you think this miRNA is real?
Comments
MIR167a is thought, like miR160, to target mRNAs coding for auxin response factors, DNA binding proteins that are thought to control transcription in response to the phytohormone auxin. Transcriptional regulation is important for many of the diverse developmental responses to auxin signals, which include cell elongation, division, and differentiation in both roots and shoots [2].

Genome context
chr3: 8108072-8108209 [+]

Database links

Mature ath-miR167a-5p

Accession MIMAT0000196
Description Arabidopsis thaliana ath-miR167a-5p mature miRNA
Sequence 19 - UGAAGCUGCCAGCAUGAUCUA - 39
Evidence experimental
cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR167a-3p

Accession MIMAT0031883
Description Arabidopsis thaliana ath-miR167a-3p mature miRNA
Sequence 101 - GAUCAUGUUCGCAGUUUCACC - 121
Evidence not_experimental

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  4. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  5. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  6. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177