sort by

10 publications mentioning chi-mir-27a

Open access articles that are associated with the species Capra hircus and mention the gene name mir-27a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 93
miR-328 was found downregulated in goats but upregulated in sheep; two miRNAs—miR-2285f-2 and miR-27a-5p were found upregulated in goats but downregulated in sheep; six miRNAs—miR-320a-1, miR-320a-2, miR-1246, miR-363, miR-760-3p, and miR-21-3p were upregulated and two miRNAs—miR-34b and miR-150 were downregulated in both species (Figure 1B and Table 3). [score:19]
In PPRV infected sheep lung, the upregulated miRNAs—miR-21-3p and miR-320a govern immune genes—TRAF6, EGFR, and ERBB4 and the downregulated miR-27a-5p potentially modulates the expression of genes—MAP3K7 and MAPK8IP3, involved in JNK signaling pathways (Figure 3B). [score:9]
miRNAs Role Tissue Reference miR-27a-5p Repression of viral replication Lung Roberts et al., 2011b miR-21-3p Induce apoptosis Lung Lo et al., 2013 miR-320a Inhibit virus infection Lung Sun et al., 2014 miR-1246 Promotes virus cytotoxicity Lung Sheng et al., 2014 miR-363 Induced apoptosis Lung and spleen Zhang et al., 2014 miR-760-3p Very highly upregulated Lung and spleen – FIGURE 2 Overview of the miRNA prediction and identification of miRNAs that regulated dysregulated proteins. [score:8]
miRNAs Role Tissue Reference miR-27a-5p Repression of viral replication Lung Roberts et al., 2011b miR-21-3p Induce apoptosis Lung Lo et al., 2013 miR-320a Inhibit virus infection Lung Sun et al., 2014 miR-1246 Promotes virus cytotoxicity Lung Sheng et al., 2014 miR-363 Induced apoptosis Lung and spleen Zhang et al., 2014 miR-760-3p Very highly upregulated Lung and spleen – FIGURE 2 Overview of the miRNA prediction and identification of miRNAs that regulated dysregulated proteins. [score:8]
Under PPRV infection miR-27a-5p was found to be upregulated in infected lung of goats but downregulated in sheep suggesting a species-specific response. [score:7]
The upregulated miR-27a-5p, miR-363, miR-320a, and miR-760-3p were observed to bring about the downregulation of IGF1R in the PPRV infected lung of goats. [score:7]
However, in infected sheep’s lung, miR-27a-5p was found to be downregulated and the rest of the five DEmiRNAs were upregulated. [score:7]
miR-27a suppresses EV71 replication by directly targeting EGFR. [score:6]
Among these 31 DEmiRNAs, six DEmiRNAs—miR-21-3p, miR-320a, miR-27a-5p, miR-1246 (expressed in lung of both species), miR-760-3p and miR-363 (expressed in lung and spleen of both species) were selected based on their role in viral infection, apoptosis and fold change. [score:5]
These miRNAs include miR-21-3p, miR-320a, miR-27a-5p, and miR-1246—expressed in lung of both species; miR-760-3p and miR-363—expressed in lung and spleen of both species (Figure 2). [score:5]
Similarly, IGF1R (insulin like growth factor 1) protein, involved in regulation of immune response was the target of miR-27a-5p, miR-363, miR-320a, and miR-760-3p. [score:4]
Recently, miR-27a-5p was found to be highly expressed in vaccinia virus infection (Buck et al., 2010). [score:3]
Among these 11 common DEmiRNAs, the expression of miR-21-3p, miR-760-3p, and miR-27a-5p was more abundant in lungs of PPRV infected goats with log [2] fold change of 5.82, 3.79, and 3.07, respectively, while miR-34b (log [2]FC = -2.53) and miR-2285f-2 (log [2]FC = -2.53) were found least abundant in lungs of goats and sheep, respectively. [score:3]
Post-transcriptional regulation of miR-27 in murine cytomegalovirus infection. [score:2]
[1 to 20 of 14 sentences]
2
[+] score: 16
Overall, we found 146 miRNAs expression changed between early-lactation and dry-lactation, with 81 up-regulation and 65 down-regulation, among which the miR-27a, miR-200a and miR-200c have been reported to involve in the milk fat metabolism process. [score:9]
MiR-27a suppresses triglyceride accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells. [score:4]
found that miR—27 suppress triglycerides accumulation in mammary epithelial cells of goat through the functional study of miR-27 [32]. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 15
Some experiments have shown that miR-27a promoted myoblast proliferation by targeting myostatin and that miR-27a is up-regulated and its target gene myostatin down-regulated during C2C12 myoblast proliferation [22]. [score:11]
To date, many muscle-specific miRNAs, miR-1, miR-133, miR-206, miR-27, were found, which have been shown to play critical roles in skeletal muscle development. [score:2]
As a member of the miR-27 family, miR-27b plays an important role in muscle development. [score:2]
[1 to 20 of 3 sentences]
4
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
5
[+] score: 7
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
From the top 30 miRNAs, we found six miRNAs (e. g., miR-23a, miR-27b, miR-103, miR-200a/b/c) to be related to lipid metabolism in human adipocyte cells: miR-23 enhances glutamine metabolism [38]; miR-27 decreases fat accumulation [27]; miR-103 regulates triglyceride content during cell differentiation [39]; and miR-200 affects insulin signaling [40]. [score:2]
[1 to 20 of 2 sentences]
6
[+] score: 7
mir-27a suppresses triglycerides accumulation and affects gene mRNA expression associated with fat metabolism in dairy goat mammary gland epithelial cells. [score:5]
Recent in vitro studies have notably revealed potential roles for miR-103 and miR-27a in the regulation of milk fat synthesis in goat mammary epithelial cells [20, 21]. [score:2]
[1 to 20 of 2 sentences]
7
[+] score: 6
Lin et al. detected that miR-27 suppresses TAG accumulation in GMEC. [score:3]
Lin et al. [40] detected that miR-27 suppresses TAG accumulation in GMEC. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 2
Other miRNAs from this paper: chi-mir-214, chi-mir-22, chi-mir-380, chi-mir-873, chi-mir-9, chi-mir-99a
These data indicate that many miRNAs are involved in HF development, and some of these miRNAs differ from those observed in previous research studies [16], although there were also some common miRNAs (miR-27a-5p, miR-99a-5p, miR-380-3p, and miR-9-5p) that deserve further attention. [score:2]
[1 to 20 of 1 sentences]
9
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7f, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
In the goat, a potential role for miR-103 and miR-27a in the regulation of milk fat synthesis in mammary epithelial cells has been reported [34, 35]. [score:2]
[1 to 20 of 1 sentences]
10
[+] score: 1
These were chi-miR-1, chi-miR-196b, chi-miR-140-3p, chi-miR-199a-5p, chi-miR-27a-3p, chi-miR-143-3p, chi-miR-135a, chi-miR-133a-3p, and chi-miR-24-3p. [score:1]
[1 to 20 of 1 sentences]