sort by

2 publications mentioning tae-MIR9654a

Open access articles that are associated with the species Triticum aestivum and mention the gene name MIR9654a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 68
Meanwhile, expression analysis indicated that the up-regulated expression trend of miR9654a-3p was opposite to that of its target gene, which exhibited a down-regulated expression pattern under drought stress. [score:15]
The relative expression level of tae-nsmR10 and tae-miR9654a-3p exhibited the up-regulated pattern while that of tae-csmR5082-1 and tae-nsmR5/tae-nsmR6 exhibited the down-regulated pattern under drought stress (Figures 5F–I). [score:9]
The expression of known miRNA tae-miR9654a-3p was up-regulated, whereas the other three novel miRNAs were down-regulated after drought stress treatment (Figures 5B–E). [score:9]
miRNA ID Targets ID Annotation tae-csmR5082-1 TC390380 Cationic peroxidase SPC4 CA637513 Arabinogalactan peptide CA644040 Arabinogalactan peptide CA634690 Arabinogalactan peptide TC436117 Arabinogalactan peptide CA645741 IAA-amino acid hydrolase TC389427 Predicted protein TC438668 Hypothetical protein TC449449 Hypothetical protein CA610228 Peroxidase CA663463 RUBISCO activase beta TC395269 beta-1,3-galactosyltransferase TC432653 DEAD-box ATP -dependent RNA helicase TC369499 1-aminocyclopropane-1-carboxylate oxidase tae-nsmR5, tae-nsmR6 TC435511 3-mercaptopyruvate sulfurtransferase TC371915 3-mercaptopyruvate sulfurtransferase tae-nsmR10 TC436629 Proline-rich receptor CA678419 Peroxiredoxin-2C DR735664 SNF1-related protein kinase catalytic subunit TC458111 Hypothetical protein CA646062 Peroxiredoxin-2C CJ793000 Trehalose-phosphate phosphatase tae-miR9654a-3p TC422325 Sulfated surface glycoprotein DR735126 Shikimate dehydrogenase DR733425 Vesicle -associated protein BJ258028 Predicted protein CJ698196 Predicted protein TC426820 Heterogeneous nuclear ribonucleoprotein Functional annotation based on GO and KEGG databases revealed that miRNA targets had various functions, involving biological processes, molecular genetics and other aspects. [score:5]
In addition, the expression trend of three miRNAs (tae-csmR5082-1, tae-nsmR5/tae-nsmR6 and tae-miR9654a-3p) showed consistent results between the TPM value and relative expression level determined by high-throughput sequencing and RT-qPCR, respectively (Figures 5C,G,D,H,E,I). [score:5]
miRNA ID Targets ID Annotation tae-csmR5082-1 TC390380 Cationic peroxidase SPC4 CA637513 Arabinogalactan peptide CA644040 Arabinogalactan peptide CA634690 Arabinogalactan peptide TC436117 Arabinogalactan peptide CA645741 IAA-amino acid hydrolase TC389427 Predicted protein TC438668 Hypothetical protein TC449449 Hypothetical protein CA610228 Peroxidase CA663463 RUBISCO activase beta TC395269 beta-1,3-galactosyltransferase TC432653 DEAD-box ATP -dependent RNA helicase TC369499 1-aminocyclopropane-1-carboxylate oxidase tae-nsmR5, tae-nsmR6 TC435511 3-mercaptopyruvate sulfurtransferase TC371915 3-mercaptopyruvate sulfurtransferase tae-nsmR10 TC436629 Proline-rich receptor CA678419 Peroxiredoxin-2C DR735664 SNF1-related protein kinase catalytic subunit TC458111 Hypothetical protein CA646062 Peroxiredoxin-2C CJ793000 Trehalose-phosphate phosphatase tae-miR9654a-3p TC422325 Sulfated surface glycoprotein DR735126 Shikimate dehydrogenase DR733425 Vesicle -associated protein BJ258028 Predicted protein CJ698196 Predicted protein TC426820 Heterogeneous nuclear ribonucleoproteinFunctional annotation based on GO and KEGG databases revealed that miRNA targets had various functions, involving biological processes, molecular genetics and other aspects. [score:5]
Additionally, three miRNA-target gene pairs (tae-nsmR10– TC436629, tae-nsmR5/tae-nsmR6– TC371915 and tae-miR9654a-3p– DR733425) exhibited opposite expression tendencies. [score:5]
These results showed that miR9654a-3p can regulate the expression of coatomer protein-related genes and affect vesicle transport of protein in cells. [score:4]
Of the 125 miRNAs identified in the present study, only four (tae-nsmR10, tae-csmR5082-1, tae-nsmR5/tae-nsmR6, tae-miR9654a-3p) were found to be differentially expressed under drought stress. [score:3]
According to gene function analysis, the target of miR9654a-3p is related to vesicle transport of protein in cells. [score:3]
Based on high-throughput sequencing data and bioinformatic analysis, four miRNAs with significantly differential expression were singled out, namely, tae-nsmR10, tae-csmR5082-1, tae-nsmR5/tae-nsmR6 (Tae-nsmR5 and tae-nsmR6 were considered to be the same miRNA because they had the same sequence) and tae-miR9654a-3p. [score:2]
These miRNAs were tae-nsmR10, tae-nsmR5/tae-nsmR6, and tae-miR9654a-3p. [score:1]
Type Gene/miRNA Forward primer 5′ → 3′ Reverse primer 5′ → 3′ Target gene Ta54825 TGACCGTATGAGCAAGGAG CCAGACAACTCGCAACTTAG TC436629 CGACTGCTTCTCCTACCT GATGCCGTTGAGGACCT TC369499 GTCGCTCCATTGCCTACTT GAACCTGGGCTCATTGTCC TC371915 GGCGTGCTTCTGGGTAT GCTTCAAATGTGGTGGG DR733425 GCTCCACCTACATTCTCG CTCTGCTGCTTTCTCAA miRNA U6 cttcggggacatccgataaaattg – tae-nsmR10 atatAGGCGCCCTGGGGGGCCGAACGGC – tae-csmR5082-1 tatataCGCGAtGAtGGCCGCGCGGGCtCAC – tae-nsmR5/6 AAACCCGGACtGtGtCGtAtGtGC – tae-miR9654a-3p gcttCtGAAAGGCttGAAGCGAAt – Lowercase, RNA; uppercase, DNA. [score:1]
The transcript signals of miRNA tae-nsmR10 and tae-miR9654a-3p in caryopses under drought stress were higher than those in control caryopses. [score:1]
[1 to 20 of 14 sentences]
2
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Of the 55 novel miRNAs, 22 showed preferential expression in the different developmental stages of wheat seed (Figure  3b), with the logarithm of the fold change of 1.0 ~ 7.6, and half of these miRNAs (tae-miR1122b, tae-miR9653, tae-miR9654a, tae-miR9656, tae-miR9657a, tae-miR9659, tae-miR2275, tae-miR9665, tae-miR1127b, tae-miR9660, tae-miR9657b and tae-miR9667) were seed specific (Figure  3b, Additional file 5). [score:4]
[1 to 20 of 1 sentences]