sort by

5 publications mentioning gga-mir-145

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-145. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 90
Herein, we confirmed that miR-145 could downregulate VEGF expression by directly binding to the 3′-UTR of VEGF, thus suggesting that AGO2 could accelerate VEGF secretion to promote blood vessel formation by inhibiting miR-145 expression in MM. [score:11]
Our study, however, revealed a novel role and mechanism of AGO2 as an enhancer of myeloma angiogenesis through miRNA dysregulation, including the upregulation of pro-angiogenic miRNAs such as the let-7 family members and the miR-17/92 cluster and downregulation of the anti-angiogenic miRNA miR-145. [score:8]
All these data support a role for AGO2 in MM angiogenesis in which AGO2 mediates the miR-145 -targeted inhibition of VEGF expression. [score:7]
Decreased expression of miR-145, which acts as a tumour suppressor to inhibit the growth, angiopoiesis and migration of tumour cells, has been observed in several types of cancer [44- 46]. [score:7]
Previous studies have revealed that miR-145 inhibits tumour angiogenesis by directly targeting VEGF [18, 33] in osteosarcoma and breast cancer. [score:6]
Moreover, we observed that AGO2 concurrently inhibited miR-145 expression in MM. [score:5]
miR-145 inhibits tumour growth and angiogenesis by targeting N-Ras and VEGF [18]. [score:5]
VEGF has been identified as a key target of miR-145 during the inhibition of tumour angiogenesis. [score:5]
Figure 6 miR-145 directly targets VEGF. [score:4]
Most let-7 family members and 2 miR-17/92 cluster members (miR-17a and miR-92-1), all known pro-angiogenic miRNAs, were positively regulated by AGO2 whereas anti-angiogenic miRNAs such as miR-145 and miR-361 were negatively regulated by AGO2. [score:3]
The pro-angiogenic miRNAs of the let-7 family and the miR-17/92 cluster, along with the anti-angiogenic miRNA miR-145, play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
miR-145 overexpression resulted in a significant decrease in the luciferase activity of the pmirGLO-reporter vector containing the VEGF 3′-UTR but not of the vector containing the corresponding mutant. [score:3]
The real-time PCR (A) and Western blot (B) detection of VEGF expression levels in U266-pcDNA3-AGO2 cells after transfection with a negative control and miR-145 mimics. [score:3]
miR-145 targets the pro-angiogenic protein VEGF. [score:3]
Therefore, the luciferase reporter assay also demonstrated that VEGF was a direct target gene of miR-145 in an MM cell line. [score:3]
Conversely, miR-145 expression was increased in the H929-si-AGO2 and LP-1-si-AGO2 cell lines and decreased in the U266-pcDNA3-AGO2 and OCI-My5-pcDNA3-AGO2 cell lines (Additional file 1: Figure S2). [score:3]
The pro-angiogenic let-7 family miRNAs, the miR-17/92 cluster and the anti-angiogenic miRNA miR-145 play crucial roles in AGO2 -mediated angiogenesis by targeting angiogenesis-related genes. [score:3]
In particular, many of these commonly dysregulated miRNAs are well-known angiogenic miRNAs, including the let-7 family members (let-7a-1, let-7a-2, let-7a-3, let-7b, let-7f-2, let-7 g and let-7i), 2 miR-17/92 cluster members (miR-17a and miR-92-1), miR-145 and miR-361. [score:2]
Anti-angiogenic miRNAs such as miR-145 and miR-361 were negatively regulated by AGO2. [score:2]
Our results also revealed that VEGF mRNA and protein expression levels in the miR-145 mimics -transfected U266-pcDNA3-AGO2 cell line were significantly decreased when compared with those in cells transfected with miRNA-NC mimics (Figure  6A,B). [score:2]
Previous studies have identified the miR-17/92 cluster, let-7 family and miR-145 as the modulators of angiogenesis [41]. [score:1]
The mimic sequences were as follows: miRNA -negative control (miRNA-NC) mimics, UUCUCCGAACGUGUCACGUTT, ACGUGACACGUUCGGAGAATT; hsa-mir-92-1 mimics, AGGUUGGGAUCGGUUGCAAUGCU, AGCAUUGCAACCGAUCCCAACCU; hsa-let-7a mimics, UGAGGUAGUAGGUUGUAUAGUU, AACUAUACAACCUACUACCUCA and hsa-mir-145 mimics, GUCCAGUUUUCCCAGGAAUCCCU, AGGGAUUCCUGGGAAAACUGGAC. [score:1]
[1 to 20 of 22 sentences]
2
[+] score: 3
The reproducibility of these results was tested by Taqman RT-PCR, selecting 18 miRNAs (hsa-let-7a, hsa-miR-141, hsa-miR-143, hsa-miR-145, hsa-miR-17, hsa-miR-182, hsa-miR-191, hsa-miR-199a-5p, hsa-miR-200a, hsa-miR-200b, hsa-miR-222, hsa-miR-29b, hsa-miR-34a, hsa-miR-424, hsa-miR-15a, hsa-miR-199a-3p, hsa-miR-26b, hsa-miR-361-3p) previously showing at least a three-fold modulation in expression in a wide panel of PDAC cell lines 49. [score:3]
[1 to 20 of 1 sentences]
3
[+] score: 3
Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer. [score:3]
[1 to 20 of 1 sentences]
4
[+] score: 3
Conversely, let-7a, let-7b, miR-132 and miR-145 show opposite expression profiles. [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, mmu-mir-92b, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. [score:1]
[1 to 20 of 1 sentences]