sort by

17 publications mentioning gga-mir-92-2

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-92-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 47
Our results show that miRNAs display a wide variety of expression profiles over the whole life of the silkworm, including continuous expression from embryo to adult (miR-184), up-regulation over the entire life cycle (let-7 and miR-100), down-regulation over the entire life cycle (miR-124), expression associated with embryogenesis (miR-29 and miR-92), up-regulation from early 3 [rd ]instar to pupa (miR-275), and complementary pulses in expression between miR-34b and miR-275. [score:18]
Four miRNAs (miR-29b, miR-34b, miR-277, and miR-285) were significantly up-regulated from the spinning larvae to adult stages, and nine (miR-305, miR-275, miR-289, miR-307-3p, miR-274, miR-286, miR-87, miR-315, and miR-92) were significantly down-regulated during this time-course (Additional file 12). [score:7]
miR-29b expression peaked in egg-removed moths, whereas miR-92 expression was maximal in the new pupae of both sexes. [score:5]
Microarray analyses revealed that miR-92 was exclusively expressed at day 6 embryo, late 2 [nd ]molt, and early pupal stages (Figure 1A), but strong expression was confirmed in day 6 embryos only by (Figure 1C). [score:5]
Whole-life analysis revealed that miR-92 expression was restricted to three time-points during the course of development from embryo to moth, and peaked at the day 6 embryo stage (Additional file 4). [score:4]
miR-92 was absent from the early 1 [st], 2 [nd], and 3 [rd ]instar larval stages, but highly expressed in late 1 [st], 2 [nd], and 3 [rd ]instar larvae and late 1 [st], 2 [nd], and 3 [rd ]molt larvae. [score:3]
Seven "early" miRNAs were detected in freshly deposited eggs (including bantam, miR-92, and miR-184-3p), which continued to be expressed until the formation of the synkaryon (6 h Em) (Additional file 5). [score:3]
miR-29b and miR-92 appeared to share similar patterns by whole-life profiling, but the detailed assay revealed evident differences between their expression profiles. [score:2]
[1 to 20 of 8 sentences]
2
[+] score: 15
These miRNAs were divided into three groups according to their expression levels in the fat broiler line, 4 highly expressed (gga-miR-21, gga-miR-148a, gga-miR-103, gga-miR-101) (2 [-ΔCt] >0.7), 4 moderately expressed (gga-miR-100, gga-miR-146a, gga-miR-92, gga-miR-2188) (0.7>2 [-ΔCt]>0.08), and 7 lowly expressed (gga-miR-1a, gga-miR-130a, gga-miR-221, gga-miR-19a, gga-miR-181b, gga-miR-458, gga-miR-17–3p) (2 [-ΔCt]<0.08) (Table 2). [score:9]
Seven miRNAs (gga-miR-148a, gga-miR-101, gga-miR-100, gga-miR-92, gga-miR-130a, gga-miR-19a and gga-miR-221) with significantly differential expression levels were found (* P<0.05; ** P<0.01). [score:3]
Furthermore, we found that two miRNAs, gga-miR-92 and gga-miR-221, were significantly differentially expressed between the two chicken lines by qRT-PCR analyses. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 14
In 7-week-old chickens, as compared with 14-day-old embryos, the expression of let-7b, miR-30a-5p, miR-30b, miR-99a and miR-133b was significantly up-regulated, but miR-16c, miR-92, miR-106, miR-203, miR-451 and miR-454 were significantly down-regulated in both dwarf and normal chickens. [score:8]
The expression of miR-16c, miR-92, miR-106, miR-203, miR-451, and miR-454 was commonly down-regulated (Table  2). [score:6]
[1 to 20 of 2 sentences]
4
[+] score: 12
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
In nine out of ten cases, we observed the same direction of song response by TaqMan as in the small RNA-seq experiment, although the P-value by TaqMan was below 0.05 in only five cases (tgu-miR-124, tgu-miR-29a, tgu-miR-92, tgu-129-5p, and tgu-miR-2954-3p, Additional File 1, Table S4). [score:2]
Five conserved miRNAs showed significant and consistent changes in copy number after song exposure across three biological replications of the song-silence comparison, with two increasing (tgu-miR-25, tgu-miR-192) and three decreasing (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p). [score:1]
Three miRNAs consistently decreased after song (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p) and two increased (tgu-miR-25, tgu-miR-192). [score:1]
To test for song-specificity of the miRNA response, we conducted a further TaqMan experiment assessing the levels of six miRNAs (tgu-miR-124, tgu-miR-92, tgu-miR-129-5p, and three miRNAs derived from the tgu-miR-2954 locus, next section), in birds who had heard either a normal song or a carefully matched non-song acoustic stimulus, "song enveloped noise" (SEN). [score:1]
In these same animals, normal song, but not SEN, triggered a significant decrease in the levels of tgu-miR-124, tgu-mir-129-5p, tgu-miR-92 and tgu-miR-2954-3p (Additional File 2, Figure S3 panels A-C, H). [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 7
Similarly, gga-miR-92-5p was highly up-regulated in resistant birds (R vs. [score:4]
Except for gga-miR-92-5p with a slight difference in the R group, the expression patterns of gga-miR-101-3p, gga-miR-126-3p, gga-miR-155, gga-miR-103-5p, and gga-miR-455 were comparable by both methods. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 6
3.4Wang et al. identified 32 known miRNAs from skeletal muscle of Arbor Acres commercial chickens, of which 12 form five clusters: miR-133a-1-miR-1a-2, miR-23b-miR-24, miR-99a-let-7c, miR-92-miR-19b-miR-18a-miR-17, and miR-30e-miR-30c-1, suggesting that most miRNAs co-express in skeletal muscle [85]. [score:3]
Wang et al. identified 32 known miRNAs from skeletal muscle of Arbor Acres commercial chickens, of which 12 form five clusters: miR-133a-1-miR-1a-2, miR-23b-miR-24, miR-99a-let-7c, miR-92-miR-19b-miR-18a-miR-17, and miR-30e-miR-30c-1, suggesting that most miRNAs co-express in skeletal muscle [85]. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 6
Moreover, in the E11_VS_P1 contrast group, eleven miRNAs (miR-6548-5p, miR-19a-5p, miR-3536, miR-6631-5p, miR-222a, miR-140-3p, miR-92-5p, miR-135a-5p, miR-455-3p, miR-460a-5p and miR-200a-3p), were highly regulated. [score:2]
Of these miRNAs, miR-6548-5p, miR-6631-5p, miR-92-5p and miR-140-3p potentially regulated of 15, 9, 7 and 7 mRNA respectively. [score:2]
In E11_VS_P1, miR-6548-5p, miR-6631-5p, miR-92-5p and miR-140-3p were regulators. [score:2]
[1 to 20 of 3 sentences]
8
[+] score: 5
Eleven of these (miR-204, miR-19a-3p, miR-19b-3p, miR-30d, miR-26a, miR-122-5p, miR-103-3p, miR-27b-3p, miR-92-3p, miR-142-3p, and miR-17-5p) have been implicated, directly or indirectly, in fat deposition; 9 showed a high fold-change (miR-3535, miR-144-3p, miR-30e-5p, miR-301b-3p, miR-215-5p, miR-200a-3p, miR-133a-3p, miR-133c-3p, and miR-146b-5p). [score:3]
Specifically, the integrated analysis of DEMs and DEGs suggests that nine miRNAs (gga-miR-19a-3p, miR-19b-3p, miR-17-5p, miR-30d, miR-26a, miR-103-3p, miR-27b-3p, miR-142-3p, and miR-92-3p) and three genes (ACSL1, FADS2 and ABCD3) are strong candidate miRNAs and genes involved in regulating the accumulation of AbF in chickens. [score:2]
[1 to 20 of 2 sentences]
9
[+] score: 4
The relative expression of gga-mir-2188, gga-mir-30c-5p and gga-mir-92-3p was significantly (p < 0.01) higher in yolk than in albumen. [score:3]
These were gga-mir-control, as an endogenous positive control and for calculating relative expression; gga-mir-183, which was not present in either fluid, as an endogenous negative control; gga-mir-2188, gga-mir-30c-5p, gga-mir-215-5p and gga-mir-92-3p all of which were present in both fluids. [score:1]
[1 to 20 of 2 sentences]
10
[+] score: 3
For reasons unknown, gga-mir-92-3p expression levels deviated from expected in all multiplex libraries. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 3
Other chicken miRNAs that are expressed at high levels in IAH30 cells include gga-miR-24 (5.5%), gga-miR-27b (4%), gga-miR-19b (3.9%), gga-miR-20a (3.9%), gga-miR-148a (3.7%), gga-miR-23b (3%), and gga-miR-92 (3%). [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 2
However, some miR-#-3p exhibited relatively increased expression levels compared with miR-#-5p (such as gga-miR-92-3p, gga-miR-7471-3p, gga-miR-130c-3p). [score:2]
[1 to 20 of 1 sentences]
13
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
For human miRNAs with same id numbers, only 2 are separated in the consensus families, namely mir-92/mir-92b and mir-449/mir-449b, showing that most of the miRNA families are robust to the variation in the input of the PBC pipeline. [score:1]
We further examined the alignments for mir-92/92b and mir-449/449b. [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 2
To explore the relationship between ANGPTL1, miR-92-1and AGO2 in MM angiogenesis, we first analysed ANGPTL1 expression in the LP-1-si-AGO2 cell line and found that it was increased in this cell line compared with the LP-1-si-NC control line. [score:2]
[1 to 20 of 1 sentences]
15
[+] score: 1
Primer name Primer sequences (5′-3′) Tm (°C) miR-17-5p-F1 ACACTCCAGCTGGGCAAAGTGCTTACAGTGCA 55 miR-17-5p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTACCTG miR-17-3p-F1 ACACTCCAGCTGGGACTGCAGTGAAGGC 55 miR-17-3p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAGTGC miR-18a-F1 ACACTCCAGCTGGGTAAGGTGCATCTAGTG 55 miR-18a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATCTGCA miR-19a-F1 ACACTCCAGCTGGGTGTGCAAATCTATGCAA 55 miR-19a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT miR-20a-F1 ACACTCCAGCTGGG TAAAGTGCTTATAGTGC 55 miR-20a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC miR-92-F1 ACACTCCAGCTGGGTATTGCACTTGTCCC 55 miR-92-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCCGG U6-F GCGCGTCGTGAAGCGTTC 55 U6-R GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATA URP GTGCAGGGTCCGAGGT DF1 cells were grown at approximately 30~50% confluence, transfected with either psiCHECK2-MAP3K2-3′UTR-WT or psi-CHECK2-MAP3K2-3′UTR-MUT and designated plasmids or miRNA inhibitors in 24-well plates using Lipofectamine 2000 (Invitrogen, USA). [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Within these clusters, the mir-92-mir-19b-mir-20a-mir-19a-mir-18a-mir-17, which is equivalent to the mammalian mir-17-92 cluster, and mir-302b-mir-302c-mir-1811-mir-302a-mir-302d-mir-367 cluster were the biggest clusters containing six miRNAs. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Namely, mammalian and amphibian genomes contain three loci of clustered microRNAs from the mir-17 and mir-92 families [72]. [score:1]
[1 to 20 of 1 sentences]