14 publications mentioning ppe-MIR156d

Open access articles that are associated with the species Prunus persica and mention the gene name MIR156d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Conversely, drought -induced up-regulation of miR156 led to down-regulation of its target gene.

The expression of miR165 and miR167 was found to be significantly down-regulated in leaf and especially root under drought stress, whereas miR156 was slightly but not significantly up-regulated in drought-stressed tissues.

Analysis of seven drought-responsive miRNAs by qRT-PCR show that the expression level of miR156 and miR168 were high in leaves and roots under drought stress in comparison to control samples while the expression of miR164 and miR395 was down-regulated in root and leaf tissues of drought-stressed samples.

Up-regulation of any miRNA expression levels was considered a positive value while negative values indicate down-regulation For miR156, miR164, miR166, miR168, miR169, miR171 and miR395, the miRNA stem-loop reverse transcription reaction was performed in a volume of 10 µL containing 2, 20, and 200 ng of total RNA samples of leaf and root samples (1 µL), 0.5 µL 10 mM dNTP mix, 1 µL stem-loop RT primer (1 µM) and 7.5 µL nuclease free water.

Our analysis also revealed that miR165 and miR167 were commonly down-regulated in both leaf and root, whereas miR156 was slightly up-regulated in root and leaf after stress treatment.

The target transcripts of Ppe-mir156, Ppe-mir166, Ppe-mir168, Ppe-mir169, Ppe-mir171, and Ppe-mir395 were obtained using psRNATarget (user-submitted transcripts and miRNA option) and BlastN algoritms.

The relative expression profile of miR156, miR164, miR168, miR171 and miR395 using qRT-PCR had a good correlation with deep sequencing.

qRT-PCR was also used for detection and quantification of predicted targets of six drougt-responsive miRNAs (miR156, miR164, miR166, miR169, miR171 and miR395).

Among them, drought responsive miRNAs (miR156, miR164, miR166, miR168, miR169, miR171, and miR395) were detected and their expression levels were measured by qRT-PCR.

Among the conserved miRNAs, total reads of miR535, miR157, miR166, miR156 and miR408 accounted for vast majority of total miRNAs; LC (82,49%), LS (89,09%), RC (75,54%) and RS (55,02%).

2

miR156 targeted the SPL family gene CNR that was reported to be involved in fruit ripening [48, 49], and the overexpression of miR156 in tomatoes downregulated the weight and the number of fruit [50], miR172 targeted the ethylene-responsive TF APETALA2a, which negatively affects ethylene synthesis and positively affects fruit ripening.

miR156 is known to target SQUAMOSA promoter binding protein–like (SPL) (Figure 3), but in our study, we found additional targets for miR156, including ATHB13, auxin-repressed protein (ARP), and inhibitor of growth protein 5 (ING5), suggesting that miR156 may have direct functions in modulating auxin response in the peach fruit.

The expression levels of miR171, miR168, miR408a, miR398 and miR408b were significantly upregulated in mesocarp in NAA -treated samples compared to the control fruits, whereas those of miR156, miR160, miR166, miR167, miR390, miR393, miR482, miR535 and miR2118 were downregulated following NAA treatment.

The results of real-time PCR experiments revealed the increased expression levels of miR171, miR168, miR408a, miR398 and miR408b, as well as the reduced expression levels of miR166, miR167, miR160, miR156, miR2118, miR535, miR390, miR482 and miR393 in the peach fruit after NAA treatment, respectively, suggesting the functional divergence of microRNAs in the regulation of fruit development.

miR156 and miR172 particularly targeted the SPL family gene colorless non-ripening (CNR) and the ethylene-responsive transcription factor gene APETALA2a, respectively, whereas miR393 targeted the AFB homolog gene SlTIR1.

In the meantime, APETALA2a is positively regulated by CNR, indicating a regulatory feedback loop between miR172 and miR156 during fruit development and ripening [21].

In the tomato fruit, miR156, miR172, miR393 and their targets were also detected [21].

Furthermore, we found that some miRNAs were also identified in the fleshy fruit of the tomato, including miR156, miR172 and miR393 [21].

We noted that miR156, miR172 and miR393 were also detected in tomatoes.

3

Moreover, over-expressed miR156 directly prevent the expression of anthocyanin biosynthetic genes (Additional file 5) by targeting SPL9, in Arabidopsis[47].

However, among the target genes, the SPL and R2R3-MYB transcription factors, both of which are known to negatively regulate flavonoid biosynthesis, were experimentally validated to be targets of miR156 and miR159, respectively [46, 47].

The target gene, SBP transcription factor, was validated to be target of miR156/157 families in three Rosa cultivars (Maroussia, Sympathy and Haedang).

We observed that the SBP transcription factor was targeted both by miR156 and miR157 families in ‘Sympathy’, whereas other SBP transcription factors were targeted only by miR156 family in Haedang and ‘Maroussia’ (Figure  5A).

Over -expression of miR156 (Figure  5A) and miR159 (Figure  5B) induced delayed flowering in Arabidopsis by negatively regulating SPL and MYB family transcription factors genes, respectively [60, 61].

miR156 and miR157 in plants have been grouped in one miRNA family due to their high degree of sequence similarity and their conserved target, the SBP transcription factors [22].

In this study, we identified nine miR156 members from all Rosa (Additional file 2), and their target genes, SPL transcription factors, were experimentally validated by 5’ RACE assay (Figure  5).

According to previous studies, miR156, miR159, and miR160 are evolutionary conserved in all land plants, and miR164, and miR172 are conserved in seed-bearing plants [57].

’, ‘Marcia’, ‘Sympathy’, and ‘Vital’, respectively) and its sequencing frequencies were 10 to 100 times more than other relatively abundant miRNA families, including miR156, miR157, and miR167 (Table  4).

4

In this study, one of the target proteins of miR156, SPL9 (GO: 2000027, ppa021582m) was annotated to function in the regulation of organ morphogenesis and to be involved in organ development, the regulation of organ morphogenesis, reproduction, system development, the hormone -mediated signaling pathway, and shoot system development (S6 Table).

Additionally, the novel m0233 (CTGACAGAAGAGAGTGAGCAC, S4 and S8 Tables) has the same 11 target genes encoding transcription factors of the SPL family as the known miR156 (TTGACAGAAGAAAGAGAGCAC, S2 and S5 Tables).

Similar results have been reported for potato [55], Aquilegia coerulea [60], and peach fruit [22], indicating that most targets of miR156 are transcription factors of the SPL family.

Eleven out of 16 targets of miR156 identified in this study are transcription factors of the squamosa promoter -binding protein-like (SPL) family (S5 Table), which is also named the SBP family in some reports [55, 60].

The total number of targets of miR156 predicted in this study varied from that found in other plant species.

However, the remaining five targets of miR156 predicted in this study encode different transcription factors than those found in potato and A. coerulea [55, 60] (S5 Table).

The most abundantly expressed miRNA family was miR156, which is represented by more than 1,910,151 reads (S2 Table), followed by miR166 with more than 39,453 reads.

miR156, miR157, and miR166 are the three most abundant known miRNAs in the peach fruit library and are also found in abundance in most plant species [23, 58] (S2 Table).

For example, miR156, miR160, miR162, miR164, miR166, miR167, miR169, miR172, miR396, and miR397 are perfectly identical to the corresponding miRNAs in three other plant species (Arabidopsis thaliana, Populus trichocarpa, and Oryza sativa) (S3 Table).

For example, the miR156 family was verified to cleave five members of the squamosa promoter -binding protein-like (SPL) transcription factor family.

Axtell and Bartel [57] reported that the miR159/319 family exists in 10 plant species, whereas miR156 has been identified in 31 different types of plants, and approximately 30% of miRNA families examined, exist in at least 10 different types of plant species.

5

The ten most highly expressed miRNAs (miR156, miR157, miR159, miR164, miR167, miR172, miR393, miR396, miR414, miR2275, and miR5021) in buds and leaves are miRNAs regulating genes involved in flower and leaf development processes such as integument development, leaf morphogenesis, meristem initiation, maintenance, and growth, bilateral symmetry determination, organ morphogenesis, plant phase transition, shoot apical meristem identity, flower and fruit development, and plant architecture.

miR156, miR159, miR166, miR172, miR390, miR396, and miR5021 are the most expressed families in bud tissues.

In silico expression analyses of miRNAs using DEGseq [25] identified 19 sequences belonging to eight conserved miRNA families (miR156, miR157, miR164, miR172, miR393, miR396, miR414, and miR2275) induced in winter buds versus leaves (Additional file 6: Table S6).

Most of conserved families common to Arabidopsis and peach (miR156, miR159, miR160, miR164, miR166, miR171, miR172, miR319, miR390, miR395, and miR396) did not show significant size variation (Figure 4).

miRNA families such as miR156, miR169, miR172, miR395, and miR5021 have the largest number of members with the latter having 18 members.

Three of these miRNA genes (miR156, miR172, and miR398) were also reported as responding to cold stress in several studies [4, 8, 10, 29, 30].

6

The largest number of targets was shown by miR156, miR172 and miR396, with 25, 21 and 22, respectively.

MiR156 and miR157 not only targeted SQUAMOSA promoter -binding protein-like (SBP domain) transcription factors, but also genes encoding proteins associated with energy metabolism, glucose metabolism, redox status and ion transport (Table S4).

The abundance of miRNA families also varied drastically: miR157, miR166 and miR156 were most frequently represented in the library, with 154,908, 79,863 and 73,043 reads, whereas miR172, miR167, miR168 and miR396 were moderately abundant in the library with 6,411, 5,280, 4,373 and 2,500 copies.

Among the miRNA families in peach, miR156, miR159, miR160, miR166, miR171, miR319, miR390 and miR396 showed a high conservation in plants, indicating that these 12 peach miRNA families are ancient.

The miR166, miR156 and miR157 families were the largest, with 15, 11 and 10 members, respectively, whereas 14 miRNA families had only a single member (Fig. 2A).

7

Recently, miR156 -targeted SPL (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE) gene was revealed negatively regulating anthocyanin biosynthesis in Arabidopsis by disrupting the MYB-bHLH-WD40 complex (Gou et al., 2011).

Cell 5, 955– –964 1547495 Gou JY Felippes FF Liu CJ Weigel D Wang JW 2011 Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156 -targeted SPL transcription factor.

8

This number was soon increased to include miR168 (inhibiting ARGONAUTE1), miR172 (inhibiting APETALA2) (Itaya et al., 2008), and miR156 (targeting CNR) (Zhang et al., 2011).

9

It is worthy to note that MiR156 and MiR157, two conserved miRNAs, not only targeted SBP TF, but also targeted genes encoding protein associated with energy metabolism, glucose metabolism, redox status, and ion transport.

10

Gou JY Felippes FF Liu CJ Weigel D Wang JW 2011 Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156 -targeted SPL transcription factor.

11

A cascade of miRNAs such as miR156, miR172 and their respective targets SQUAMOSA PROMOTER BINDING PROTEIN-LIKE, and AP2 like genes are involved in modulating flowering induction in Arabidopsis through FT and other flowering related genes (Khan et al., 2014; Spanudakis and Jackson, 2014).

In the aging pathway, it has been found that the role of five microRNAs (miRNAs) families called miR156, miR172, miR159/319, miR390, and miR399 is important in flowering time (Spanudakis and Jackson, 2014).

12

An miRNA cascade involving miR156 and miR172 and their respective targets SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL), and APETALA2 (AP2)-like genes modulates flowering induction in Arabidopsis through the regulation of FT and other flowering-related genes (Khan et al., 2014; Spanudakis and Jackson, 2014).

13

[22] SPLs are a component of the miR156 (micro RNA 156) mediated-age pathway in Arabidopsis, with SPL levels gradually increasing during the transition from the juvenile to adult states.

14

In some cases no mismatches were reported with the conserved sequences present in miRBase (e. g., miR403, miR394, miR166, miR156) while in some others mismatches were present and related to differences in the sequence and/or in its length.