sort by

7 publications mentioning bta-mir-503

Open access articles that are associated with the species Bos taurus and mention the gene name mir-503. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 55
To validate whether the SMAD7 and ACVR2A gene are real targets of the miR-424/503 cluster, fragments of the 3´-UTR of SMAD7 or 3´-UTR of ACVR2A containing the binding sites for miR-424-5p (miR-424) and miR-503-5p (miR-503) (wild type) or with mutations in the seed sequences of miR-424/503 (mutant type) (Fig.   1) were cloned and inserted between the SacI and XhoI restriction sites of the pmirGLO Dual-Luciferase miRNA Target Expression Vector (Promega Corporation, USA). [score:8]
Flow cytometric analysis showing the cell cycle distribution (G1/G0, S and G2/M phases) of propidium iodide (PI)-labeled bovine granulosa cells transfected with the mimic negative control (NC) (a), miR-424 mimic (b), miR-503 mimic (c), inhibitor NC (d), miR-424 inhibitor (e), or miR-503 inhibitor (f). [score:7]
On the other side, miRNA prediction for SMAD7 target gene using TargetScan revealed that miR-424-5p was top predict with 8mer site type (an exact match to positions 2–8 of the mature miRNA (the seed + position 8) followed by an ‘A’); while, miR-503-5p showed 7mer-A1 site type (an exact match to positions 2–7 of the mature miRNA (the seed) followed by an ‘A’). [score:5]
Overexpression of miR-424 and miR-503 decreased the SMAD7 and ACVR2A mRNA (a) and protein (b) expression. [score:5]
org) to generate an algorithm to identify putative targets, which revealed that miR-424 and miR-503 target SMAD7 and ACVR2A. [score:5]
The chemically synthesized miRNA-424-5p mimic and inhibitor, miR-503-5p mimic and inhibitor, and the corresponding negative controls (NC) were used to transfect (Qiagen GmbH, Germany) bGCs. [score:5]
The relative expression levels of PCNA (b), STAR (c), SMAD7 (e), ACVR2A (f), miR-424 (g) and miR-503 (h) in granulosa cells treated Activin A. The protein expression of STAR in granulosa cells treated with treated Activin A (d). [score:5]
Overexpression of miR-503 mimic could not increase the expression of SMAD2/3 or phosphorylated SMAD2/3 protein level compared to mimic negative control (4D). [score:4]
Conversely, compared to the miRNA inhibitor control, bGCs transfected with miR-424 and miR-503 inhibitors showed no significant differences in proliferation activity. [score:4]
The minimum free energies (kcal/mol) of miR-424 (e) and miR-503 (f). [score:1]
Relative luciferase activity in bovine granulosa cells co -transfected with pmiRGLO vector harbouring the wild-type (WT) or mutant (MT) 3´-UTR sequence of SMAD7 or ACVR2A and the corresponding miRNA mimics or negative controls (NC) for miR-424 and miR-503. [score:1]
The precursors of bta-miR-424-5p (miR-424) and bta-miR-503-5p (miR-503) are 96 bp and 83 bp, respectively. [score:1]
The mature sequences of bta-424-5p and miR-503-5p are CAGCAGCAAUUCAUGUUUUGA and UAGCAGCGGGAACAGUACUG, respectively, which are conserved in other mammalian species. [score:1]
The secondary structure of miR-424 and miR-503 was predicted by RNAhybrid (http://bibiserv. [score:1]
However, miR-503 had no significant effect on cell proliferation. [score:1]
The mature sequences of miR-424-5p (miR-424) and miR-503-5p (miR-503) were obtained from the miRBase (http://www. [score:1]
[1 to 20 of 16 sentences]
2
[+] score: 9
The expression difference of miR-503 and miR-660 was not statistically significant in the qPCR analysis (Fig. 4B). [score:3]
Real-time of the selected miRNA confirmed the trends observed in the microarray analysis; however, the expression differences of miR-503 and miR-660 were not statistically significant (Fig. 4). [score:3]
A few high-throughput studies have confirmed some of the identified miRNAs (miR-1, miR-128, miR-133a, miR-133b, miR-206, miR-222, and miR-503) as common for skeletal muscle development in mouse, human, pig, common carp [11], and cattle [25]. [score:2]
Besides the abovementioned miRNAs promoting myoblast differentiation, a few identified molecules such as miR-29b [49], miR-31 [50], miR-9 [51], miR-145 [52], miR-194 [53], miR-378 [54], miR-449 [55], miR-503 [11, 27], miR-542, [56], and miR-660 [11] were described in the literature as skeletal muscle-related. [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 5
A previous study showed that miR-322/424 and miR-503 can promote cell differentiation by enhancing cell cycle arrest through the inhibition of cell cycle regulator Cdc25A [32]. [score:4]
MiR-148a, miR-206 and miR-214 have been shown to be similar to miR-322/424 and miR-503 [12, 33, 34]. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 5
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-27a, bta-mir-320a-2, bta-mir-99a, bta-mir-125a, bta-mir-181a-2, bta-mir-27b, bta-mir-10a, bta-mir-139, bta-mir-140, bta-mir-181b-2, bta-mir-487a, bta-let-7d, bta-mir-124a-1, bta-mir-181c, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-154a, bta-mir-181d, bta-mir-184, bta-mir-206, bta-mir-29d, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-486, bta-mir-495, bta-mir-95, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2286, bta-mir-2300a, bta-mir-2300b, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2319a, bta-mir-2319b, bta-mir-2284n, bta-mir-2284g, bta-mir-2329-1, bta-mir-2329-2, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2396, bta-mir-2285c, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2443, bta-mir-2284h, bta-mir-2450c, bta-mir-2450b, bta-mir-2450a, bta-mir-2404-2, bta-mir-2284o, bta-mir-2484, bta-mir-2284e, bta-mir-320a-1, bta-mir-2887-1, bta-mir-2887-2, bta-mir-2284w, bta-mir-3431, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-574, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac, bta-mir-3432b, bta-mir-2450d
miR-503 (log [2] (MDSC-D3/MDSC-P) = 1.39) suppressed cell proliferation and cell cycle progression, and promoted cell cycle quiescence by targeting cyclin D1 [44]. [score:5]
[1 to 20 of 1 sentences]
5
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-148d
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 1 sentences]
6
[+] score: 3
Other miRNAs from this paper: bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-107, bta-mir-140, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-let-7g, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-1-2, bta-mir-1-1, bta-mir-101-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-152, bta-mir-154a, bta-mir-185, bta-mir-199a-2, bta-mir-206, bta-mir-30f, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-370, bta-mir-378-1, bta-mir-432, bta-mir-9-1, bta-mir-9-2, bta-mir-1224, bta-mir-376b, bta-mir-376d, bta-mir-376c, bta-mir-376a, bta-mir-1839, bta-mir-1185, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-199c, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-378-2, bta-mir-2284w, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-3604-1, bta-mir-3604-2, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-376e, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-3432b, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
For example, the expression of miR-101, miR-432, and miR-185 was higher in fetal bovine backfat tissue than the patterns shown by miR-199a, miR-503, and miR-154c in adult bovine backfat tissue. [score:3]
[1 to 20 of 1 sentences]
7
[+] score: 1
04.53:446874:446894:-1 [f] Intronic bomir-503-3p 23 mmu-miR-503 1 +UGCAGUACUGUUCCCGCUGCUAUn. [score:1]
[1 to 20 of 1 sentences]