sort by

46 publications mentioning ssc-let-7f-2

Open access articles that are associated with the species Sus scrofa and mention the gene name let-7f-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 331
Here we report that MYH9 is the direct target of let-7f-5p, which regulates MYH9 expression via binding to its mRNA 3′UTR, resulting in the downregulation of MYH9 expression at both the posttranscriptional and translational level. [score:14]
We next asked the question of whether the downregulation of let-7f-5p was linked to the concomitant upregulation of expression of its target, MYH9 mRNA, in PRRSV-infected PAMs. [score:11]
We demonstrate that overexpression of let-7f-5p can inhibit PRRSV replication through suppression of MYH9 expression. [score:9]
PRRSV infection markedly downregulated let-7f-5p expression and upregulated MYH9 in PAMs infected with both PRRSV strains (Fig. 7). [score:9]
These results suggest that the downregulation of let-7f-5p likely upregulates MYH9 expression in PRRSV-infected PAMs. [score:9]
As shown in Fig. 1b, luciferase activity was downregulated in the presence of either let-7f-5p or mml-miR346 mimics, resulting in respective decreases of 62% and 58% in luciferase expression relative to psiCheck2-pMYH9-WT expression. [score:8]
To investigate whether let-7f-5p directly targets the MYH9 expression via binding to its mRNA 3′UTR, wild type (WT) target sequences and site-directed mutant sequences were cloned into the luciferase reporter vector (Figs 2b and 3b). [score:7]
Based on the observation that let-7f-5p is downregulated during PRRSV infection, we propose that downregulation of let-7f-5p could, in a context-specific manner, offer an advantage to PRRSV. [score:7]
Similarly, western blotting showed that the level of MYH9 expression was increased by transfection of 200 nM let-7f-5p inhibitor relative to that achieved by transfection of a negative control inhibitor (Fig. 6c). [score:7]
To confirm the effect of let-7f-5p on MYH9 expression, PAMs were transfected with let-7f-5p inhibitor and the negative control, then the expression of let-7f-5p and MYH9 were examined at the indicated times. [score:7]
Notably, 100 nM let-7f-5p could markedly inhibit both MYH9 expression and viral replication, resulting in reduction in virus copy number by 83%, ORF7 mRNA by 80%, and reduction of protein expression levels (Fig. 8a–c). [score:7]
However, disruption of the seed sequence in plasmids containing the mutated pig MYH9 3′UTR (psiCheck2-pMYH9-MUT) or the mutated monkey MYH9 3′UTR (psiCheck2-mMYH9-MUT) ablated the ability of let-7f-5p to inhibit the expression of luciferase (Figs 2c right and 3c right, respectively), supporting the view that let-7f-5p targeted MYH9 mRNA via specific binding to its 3′UTR. [score:7]
Our results showed that overexpression of let-7f-5p in PAMs significantly downregulated both mRNA and protein levels of MYH9 (Fig. 5). [score:6]
The results show that MYH9 is a direct target for let-7f-5p and that let-7f-5p -mediated suppression of MYH9 is dependent on the MYH9 3′-UTR sequence. [score:6]
These results suggest that let-7f-5p might regulate MYH9 expression through both mRNA degradation and translational repression. [score:6]
PRRSV infection of PAMs by both HP-PRRSV and N-PRRSV strains downregulated the expression of let-7f-5p and several other let-7 family members, including let-7i-5p, let-7d-5p, and let-7g-5p, resulting in greater virus infectivity. [score:6]
The potential for one miRNA to regulate numerous mRNAs and for one mRNA to be targeted by multiple miRNAs suggests that there may be other host genes regulated by let-7f-5p that limit PRRSV proliferation. [score:5]
PRRSV replication is suppressed by overexpression of let-7f-5p. [score:5]
In order to elucidate whether PRRSV infection affects the expression of let-7f-5p, microRNA let-7 family member expression in response to PRRSV infection was checked in PAMs. [score:5]
Collectively, these results demonstrate that there is an inverse correlation between the expression of let-7f-5p and expression of MYH9. [score:5]
Notably, let-7f-5p dramatically inhibited luciferase expression for both psiCheck2-pMYH9-WT (Fig. 1b) and psiCheck2-mMYH9-WT (Fig. 1c). [score:5]
The miRNA identified as potentially targeting pig MYH9 mRNA was let-7f-5p, whereas miRNAs potentially targeting monkey MYH9 mRNA were let-7f-5p, mml-miR-638, and mml-miR-346. [score:5]
Inhibition of let-7f-5p enhances MYH9 mRNA and protein expression in PAMs. [score:5]
of luciferase activity assays showed that let-7f-5p regulated luciferase expression by targeting both pig and monkey MYH9 3′UTR (Fig. 1). [score:5]
Let-7f-5p regulates MYH9 expression through both mRNA degradation and translational repression. [score:5]
A similar inhibition of CH-1a replication was observed in let-7f-5p -overexpressing PAMs, where viral titers in the supernatants decreased by 0.29, 1, 1.08, and 1.17 log10 relative to control cell titers at 6 hpi, 12 hpi, 24 hpi, and 36 hpi, respectively (Fig. 9h). [score:5]
As shown in Fig. 6, let-7f-5p inhibitor transfection led to a significant reduction in let-7f-5p mRNA expression level (Fig. 6a). [score:5]
How to cite this article: Li, N. et al. MicroRNA let-7f-5p Inhibits Porcine Reproductive and Respiratory Syndrome Virus by Targeting MYH9. [score:5]
PAMs were transfected with indicated concentrations of MYH9-siRNA, NC-siRNA, let-7f-5p -inhibitor, and NC -inhibitor. [score:5]
As shown in Fig. 5, expression of let-7f-5p in the various groups was examined by qRT-PCR and normalized against U6 rRNA expression (Fig. 5a). [score:5]
Together, these results are consistent with the interpretation that let-7f-5p inhibits both HP-PRRSV and N-PRRSV replication in PAMs and the inhibitory effect induced by let-7f-5p lasts for at least 36 hpi. [score:5]
When PAMs were transfected with 200 nM let-7f-5p inhibitor for 24 h, the expression level of MYH9 mRNA was increased by 62% compared with that of negative control (Fig. 6b). [score:4]
Collectively, qRT-PCR and western blot assays revealed that let-7f-5p markedly inhibits the expression of MYH9 at both mRNA and protein levels. [score:4]
Target mutations were made to the “seed region” of the let-7f-5p binding site in porcine MYH9 (pMYH9) and murine MYH9 (mMYH9), then the oligonucleotides were synthesized, annealed into double strands, and cloned into the psiCheck-2 vector. [score:4]
MYH9 mRNA and protein levels were augmented in cells transfected with let-7f-5p inhibitor compared to cells transfected with control inhibitor (Fig. 6). [score:4]
To further investigate whether let-7f-5p can regulate MYH9 expression, PAMs were transfected with let-7f-5p, NC mimics, siMYH9 (as a positive control), or NC siRNA; the expression of let-7f-5p and MYH9 mRNA were examined at the indicated times. [score:4]
A striking observation was the downregulation of let-7f-5p miRNAs in both HP- and N-PRRSV-infected PAMs. [score:4]
These results demonstrate that let-7f-5p directly targets the 3′UTR of MYH9 mRNA in a sequence-specific manner. [score:4]
Let-7f-5p, targeted to bind to the 3′UTR of MYH9, bound directly to the 3′UTR. [score:3]
At the same time, expression of MYH9 protein in PAMs, which were transfected with let-7f-5p mimics, siMYH9, or negative controls for 36 h, was also detected by western blot. [score:3]
Overexpression of let-7f-5p decreases MYH9 mRNA and protein levels in PAMs. [score:3]
To understand the expression patterns of let-7 family members during PRRSV infection, we profiled host miRNAs in PAMs during HP-PRRSV and N-PRRSV infections using a deep sequencing approach. [score:3]
To identify let-7f-5p targets regulated through base pairing between the miRNA “seed region” and the 3′UTR of the pig and monkey MYH9, the microRNA-mRNA relationship was validated using luciferase activity assays (Figs 2 and 3) and Ago2-IP analysis (Fig. 4). [score:3]
Both PRRSV growth and ORF7 mRNA levels were inhibited in a dose -dependent manner and cells transfected with a higher dose of let-7f-5p displayed a stronger antiviral effect. [score:3]
As shown in Fig. 7d,e, let-7f-5p was greatly reduced in PAMs infected with both PRRSV strains as early as 6 hpi and its expression remained lower in the PRRSV-infected PAMs than in mock and UV-inactivated virus controls at 12 hpi and 24 hpi. [score:3]
To further examine viral replication inhibition caused by let-7f-5p, PAMs were transfected with 100 nM let-7f-5p mimics or NC mimics. [score:3]
Our results show that let-7f-5p can inhibit viral replication of both HP-PRRSV and N-PRRSV in PAMs (Figs 8 and 9). [score:3]
The expression level of MYH9 mRNA in cells transfected with the siMYH9 and let-7f-5p mimics were lower than that of the NC group. [score:3]
The let-7 family contains some members with highly conserved sequences in species ranging from worms to humans, which share several conserved mRNA targets 17 36. [score:3]
Similarly, the mutant let-7f-5p (let-7f-5p-MUT), which restored base complementarity with mutated MYH9 3′UTR sequences, did not block the luciferase expression from psiCheck2-pMYH9-WT and psiCheck2-mMYH9-WT (Figs 2c left and 3c left, respectively). [score:3]
To further confirm the let-7f-5p expression profile associated with PRRSV infection, the levels of let-7f-5p in PAMs were detected using qRT-PCR. [score:3]
Relative expression level of let-7f-5p (a) and MYH9 mRNA (b) in PAMs determined by qRT-PCR. [score:3]
PRRSV ORF7 (b,c), let-7f-5p (d,e), and MYH9 (f,g) mRNA relative expression levels were determined using qRT-PCR. [score:3]
Moreover, we observed that let-7f-5p has a significant impact on PRRSV infection and this result is consistent with previous observations showing that microRNAs are small RNAs with great power; differential regulation by let-7 family miRNAs has previously been shown to participate in regulation of the immune response to many virus infections. [score:3]
As shown in Fig. 9a,b, significant decreases were observed in MYH9 mRNA expression after let-7f-5p transfection. [score:3]
Similar expression patterns were observed for several other let-7 miRNA members (Fig. 7a). [score:3]
RNA of mock- and GD-HD-infected PAMs were subjected to Ago2-IP, the relative expression of let-7f-5p (a) and MYH9 mRNA (b) in the immunoprecipitates were determined by qRT-PCR. [score:3]
A let-7f-5p decrease accompanied enhanced MYH9 expression in PRRSV-infected PAMs. [score:3]
Overexpression of let-7f-5p attenuates both HP-PRRSV and N-PRRSV replication in PAMs. [score:3]
Only let-7f-5p mimics significantly decreased luciferase expression (by 56%) relative to psiCheck2-mMYH9-WT (Fig. 1c). [score:3]
The expression of let-7f-5p and MYH9 was further validated by quantitative real-time PCR. [score:3]
In addition, let-7f-5p and its target sites are both conserved among different host species (Figs 1c and 4a). [score:3]
As shown in Figs 2c and 3c, let-7f-5p significantly inhibited the luciferase activity of psiCheck2-pMYH9-WT (Fig. 2c left) and psiCheck2-mMYH9-WT (Fig. 3c left). [score:3]
To further demonstrate the direct interaction between let-7f-5p and MYH9 mRNA, immunoprecipitation (IP) analysis was carried out using anti-Ago2 antibody and cell lysates. [score:2]
Let-7f-5p inhibits both HP-PRRSV and N-PRRSV replication. [score:2]
These results demonstrate that let-7f-5p directly interacts with MYH9 mRNA in the RISC. [score:2]
Moreover, MYH9 expression in cells treated with let-7f-5p mimics or siMYH9 was markedly reduced compared with negative control (Fig. 5c). [score:2]
Notably, when PAMs were transfected with 100 nM let-7f-5p mimics for 24 h, the expression level of MYH9 mRNA decreased by 55% compared with that of negative controls (Fig. 5b). [score:2]
Using bioinformatics prediction and experimental verification, we demonstrated that let-7f-5p is a key regulator of MYH9. [score:2]
The positions of six seed match sites for let-7f-5p in the monkey MYH9 3′UTR were replaced. [score:1]
Notably, although the members share the same “seed region”, let-7 family members are each unique and encoded on different chromosomes. [score:1]
Luciferase reporter activity assay identifies let-7f-5p as a regulator of MYH9. [score:1]
PAMs were transfected with NC mimics or various concentrations of let-7f-5p and infected with PRRSV strain GD-HD (MOI = 0.01) for 24 hrs. [score:1]
PAMs were transfected with 100nM of MYH9-siRNA, NC-siRNA, let-7f-5p mimics, and NC -mimics. [score:1]
The inhibition observed for virus titers, as measured by TCID [50], was significantly reduced in let-7f-5p -transfected GD-HD-infected PAMs at 12 hpi and 24 hpi; viral titers in the supernatant decreased by 0.83 and 0.71 log10 relative to control cell titers at 12 hpi and 24 hpi, respectively (Fig. 9g). [score:1]
PAMs were transfected with 100 nM let-7f-5p or NC mimics, followed by infection with two PRRSV strains: GD-HD and CH-1a (MOI = 0.01). [score:1]
In contrast, let-7f-5p-MUT significantly decreased the luciferase activity of psiCheck2-pMYH9-MUT and psiCheck2-mMYH9-MUT (Figs 2c right and 3c right, respectively). [score:1]
The let-7f-5p and MYH9 mRNA in the co-precipitates were quantitated using qRT-PCR. [score:1]
These observations, coupled with the fact that let-7f-5p is well conserved among different host species (Fig. 1d), led us to choose let-7f-5p for further validation studies. [score:1]
psiCheck2-mMYH9-MUT plasmids (50 ng) and let-7f-5p mimics, let-7f-5p-MUT mimics, or NC mimics (100 nM) by using X-tremeGENE siRNA Transfection Reagent (Roche, Basle, Switzerland). [score:1]
Next, let-7f-5p miRNA and MYH9 mRNA in the immunoprecipitates were detected by qRT-PCR. [score:1]
To investigate whether the activation of let-7f-5p affects PRRSV replication through targeting of the MYH9 gene, PAMs were transfected with increasing concentrations of let-7f-5p mimics (20, 50, 100 nM) or NC mimics (100 nM), followed by infection with the GD-HD strain at an MOI of 0.01. [score:1]
There are two putative MYH9 seed match sequences with perfect complementarity to let-7f-5p, each with an MFE of <–20 kcal/mol. [score:1]
The positions of six seed match sites for let-7f-5p in the pig MYH9 3′UTR were replaced. [score:1]
[1 to 20 of 84 sentences]
2
[+] score: 43
of differentially expressed porcine miRNAsTarget genes for the eight differentially expressed miRNAs (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126 [*], Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f) were predicted in silico. [score:7]
There are similar cases with low expressed miRNAs (according to sequence count) such as Ssc-let-7f, which was more expressed in Asian breeds but appears up regulated in European breeds in real time RT-qPCR data. [score:6]
According to sequence count, nine miRNAs highly expressed (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Ssc-miR-532-5p, Ssc-miR-92a, Ssc-miR-26a and Bta-miR-193b, n>100) and four miRNAs lowly expressed (Ssc-miR-423-5p, Ssc-miR-29c, Ssc-miR-486 and Ssc-let-7f, n<100) in the kidney miRNAome were selected to measure their expression levels by RT-qPCR. [score:5]
Target genes for the eight differentially expressed miRNAs (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126 [*], Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f) were predicted in silico. [score:5]
Ssc-miR-99a, Bta-miR-193b and Ssc-miR-423-5p were selected to be up regulated in EU, Hsa-miR-200b-3p, Ssc-miR-532-5p and Ssc-let-7f to be up regulated in AS and, Hsa-miR-200c-3p, Ssc-miR-92a, Ssc-miR-26a, Ssc-miR-486 and Ssc-miR-29c to be up regulated in EA. [score:4]
Significant differential expression regarding breed groups was obtained by RT-qPCR in eight miRNAs: Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f. [score:3]
Additionally, looking at normalised counts for each breed (Table S6), there were some miRNAs with low frequency which their expression was higher in some breed, such as Hsa-miR-193b-5p, Hsa-miR-140-5p, Ssc-miR-19b, Ssc-miR-423-5p and Ssc-miR-24 in Iberian breed, Ssc-miR-151-5p, Hsa-miR-4454, Ssc-miR-199a-3p and Ssc-miR-374b-5p in Landrace breed, Ssc-miR-486 in Piétrain breed and Ssc-let-7f and Hsa-let-7i-5p in Meishan breed. [score:3]
Ssc-let-7f is an ubiquitous miRNA from let-7 family, related to many pathways involved in wide range of physiological functions (cellular, metabolic and environmental information processes) and also to many diseases, like renal cell carcinoma [81], [82]. [score:3]
Relative quantification from RT-qPCR data determined that Hsa-miR-200b-3p, Bta-miR-193b and Ssc-let-7f were up regulated in EU while Ssc-miR-126, Ssc-miR-126* and Ssc-miR-99a were down regulated in AS. [score:3]
Eight miRNAs (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Bta-miR-193b, Ssc-miR-486 and Ssc-let-7f) were differentially expressed in at least one comparison by RT-qPCR (p-value<0.05) (Table 6). [score:3]
Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a and Ssc-let-7f have also been described in some cancer pathways, emphasizing the importance of miRNAs in pathways related with cell cycle, growth and death. [score:1]
[1 to 20 of 11 sentences]
3
[+] score: 32
This study used high-throughput sequencing to compare miRNA expression in pigs susceptible and resistant to E. coli F18 infection and identified 12 miRNAs with differential expression, including 11 upregulated in susceptible animals, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one down-regulated, ssc-miR-152. [score:11]
miRNAs overexpressed in E. coli F18-sensitive individuals include ssc-miR-143 (highest expression), ssc-let-7f, ssc-miR-143, ssc-miR-192, ssc-miR-21, ssc-miR-215, ssc-miR-378, ssc-miR-145, ssc-miR-26a, and ssc-miR-30e. [score:5]
These included 11 with increased miRNA expression in E. coli F18-sensitive pigs, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one with reduced miRNA expression, ssc-miR-152. [score:5]
Let-7f inhibits IL-23 receptor expression in human CD4 [+] T cells [18]. [score:4]
In addition, the expression of miR-15b, miR-152, miR-143-5p, and let-7f were significantly different in the E coli F18-sensitive and -resistant groups (p<0.05). [score:3]
MiRNAs with a mean value >10000 by sequence counting (i. e., expression) included ssc-miR-143, ssc-let-7f, ssc-miR-192, ssc-miR-21, ssc-miR-215 and ssc-miR-378. [score:3]
l Note: 1, ssc-miR-27b; 2, ssc-miR-215; 3, ssc-miR-21; 4, ssc-miR-192; 5, ssc-miR-15b; 6, ssc-miR-148a; 7, ssc-miR-143–5p; 8, ssc-let-7f; 9, ssc-miR-152. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 29
For example, the miR-133 family (ssc-miR-133b, ssc-miR-133a-3p) as well as the let-7 family (ssc-miR-98, ssc-let-7e) was up-regulated in Bama minipigs; in the miR-1/206 family, ssc-miR-1 was up-regulated whilst ssc-miR-206 was down-regulated in Bama minipigs. [score:10]
Of these, 40 miRNAs are minimally expressed (0 < average signals ≤ 100; p ≤ 0.01), 77 miRNAs are modestly expressed 100 < average signals ≤ 1,000; p ≤ 0.01), 85 miRNAs were highly expressed (1,000 < average signals ≤ 10,000), and, in particular, 20 miRNAs were extremely highly expressed in the anterior pituitary (average signals ≥ 10,000; p ≤ 0.01), including ssc-miR-7, Y-90, ssc-miR-26a, ssc-miR-125b, Y-1, ssc-miR-125a, Y-77, ssc-let-7g, ssc-miR-29a, ssc-let-7i, ssc-let-7a, ssc-let-7f, ssc-miR-148a, ssc-miR-21, ssc-miR-335, ssc-miR-30b-5p, ssc-miR-191, ssc-miR-29c, ssc-miR-23b, and ssc-miR-23a (Fig 1C). [score:9]
It has been well demonstrated that let-7, miR-193-3p, and miR-195 were down-regulated in GH-secreting pituitary adenomas that accompanied excessive GH secretion[42, 43] and our previous study demonstrated that over -expression of ssc-let-7c in porcine pituitary cells leads to a decrease in GH secretion[44]. [score:6]
In the present study, we observed that two members of the let-7 family (let-7e and ssc-miR-98) as well as miR-193-3p and miR-195 were significantly up-regulated in Bama minipigs. [score:4]
[1 to 20 of 4 sentences]
5
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
Interestingly, the expression abundance varies among the let-7 family members (Tables 1 and 2); let-7a and let-7j, each have 80 reads; similarly, let-7b, let-7c and let-7e have almost the same number of reads (63–64); let-7d, let-7f and let-7j have 18 to 32 reads; and let-7h, let-7i and let-7k have a lower number of reads (5–9) (Tables 1 and 2). [score:3]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
Hence the let-7 miRNA family is represented by 11 members, and this study provides the evidence for the expression of all 11 let-7 family members in pig. [score:3]
Here, we found evidence for the expression of all 10 let-7 members in pig. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
Similarly, let-7, miR-98, miR-16 and miR-130a are abundantly expressed in 13 of the 14 tissues (except in pancreas) (Figure 3A). [score:3]
let-7, miR-98, miR-130a and miR-16 showed uniform levels of expression in 13 different tissues but were hardly detected in pancreas (Figure 3A). [score:3]
The miR-98 sequence differs from that of the let-7 family by one nt at position 11 from the 5' end, thus miR-98 is also a member of the let-7 family. [score:1]
The let-7 family has 10 members in diverse animal species (miRBase). [score:1]
[1 to 20 of 10 sentences]
6
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
To identify whether highly expressed miRNAs play key roles in skeletal muscle development, the target genes of 25 miRNAs with the most abundance (not including let-7 family for their ubiquitous expression) in ten libraries (Table 1) were predicted and total 2325 target genes were found. [score:10]
0072418.g003 Figure 3 A. 31 significantly enriched KEGG pathways were achieved using the target genes of the most abundant 25 miRNAs (not including let-7 family) in ten libraries; B. comparison of KEGG pathways significantly enriched during skeletal muscle development at 35 to 77dpc (LR 1-4), 77dpc to 28 dpn (LR 4-7) and 28 to 180 dpn (LR 7-10). [score:4]
KEGG Orthology analysis of the most abundant 25 common miRNAs (excluding let-7 family) from 10 libraries indicated that their involvement in the regulation of canonical myogenesis-related pathways and diseases (Figure 5). [score:4]
Stem-loop quantitative RT-PCR was then performed on 9 random miRNAs with different expression levels (miR-1, -206, -133a-3p, -133a-5p, -133b, -378, -214, -744 and let-7f) to validate the sequencing data (Figure 6). [score:3]
[1 to 20 of 4 sentences]
7
[+] score: 21
It has been established that miRNAs can target specific genes [23]; in the present study, let-7c, let-7 g, miR-18a, miR-196b, and miR-9 targeted MAP3K7, and miR-196b and miR-19b targeted dipeptidyl-peptidase 8 (DPP8), suggesting that cellular miRNAs play a key role in regulating gene expression in response to PPV infection. [score:10]
Among them, let-7 g, miR-17-5p, miR-17-3p, miR-20a, miR-181a, miR-16, miR-146b, miR-10b, and miR-155-5p were upregulated; let-7c, miR-122, miR-18a, miR-19a, miR-19b, miR-196b, miR-21, and miR-9 were downregulated. [score:7]
Let-7 g, let-7c, miR-19b, and miR-16 are involved in immune-related programs and may act through the target gene IL10. [score:3]
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 21
Let-7, miR-15 and miR-133 families possessed at least two members, more interestingly, these miRNAs shared similar expression profile (up-regulated). [score:6]
The let-7 family (let-7a, let-7c) was up-regulated in this study, suggesting their transcription and maturation might also be induced directly by gonadotropin-releasing hormone. [score:5]
Prediction via software indicated that the let-7 family might target FSHβ with perfect match in seed sequence and high conservation among species (mouse and pig, data not shown), which indicated a potential role of the let-7 family in the regulation of FSH secretion. [score:4]
Among all differentially expressed miRNAs, miR-133, miR-15/195 and let-7 families had two members. [score:3]
h CAAAUGC ssc-miR-19b 1.50 miR-19 GUGCAAA ssc-miR-183 1.47 miR-183 AUGGCAC ssc-miR-423-3p 1.46 miR-423/423-3p GCUCGGU ssc-miR-206 1.46 miR-1/206 GGAAUGU ssc-miR-15a 1.42 miR-15/16/195/424/497 AGCAGCA ssc-miR-22-5p 1.39 miR-22-5p/3568 GUUCUUC ssc-miR-133a-3p 1.39 miR-133 UUGGUCC ssc-miR-340 1.37 miR-340/340-5p UAUAAAG ssc-let-7a 1.37 let-7/98 GAGGUAG ssc-miR-338 1.36 miR-338/338-3p CCAGCAU ssc-miR-361-5p 1.35 miR-361/361-5p UAUCAGA 10.1371/journal. [score:1]
h CAAAUGC ssc-miR-19b 1.50 miR-19 GUGCAAA ssc-miR-183 1.47 miR-183 AUGGCAC ssc-miR-423-3p 1.46 miR-423/423-3p GCUCGGU ssc-miR-206 1.46 miR-1/206 GGAAUGU ssc-miR-15a 1.42 miR-15/16/195/424/497 AGCAGCA ssc-miR-22-5p 1.39 miR-22-5p/3568 GUUCUUC ssc-miR-133a-3p 1.39 miR-133 UUGGUCC ssc-miR-340 1.37 miR-340/340-5p UAUAAAG ssc-let-7a 1.37 let-7/98 GAGGUAG ssc-miR-338 1.36 miR-338/338-3p CCAGCAU ssc-miR-361-5p 1.35 miR-361/361-5p UAUCAGA 10.1371/journal. [score:1]
It was reported that lin-28a played an important role in processing pri-let-7 to mature let-7 [38], [39]. [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 20
A previous study reported that overexpression of let-7 resulted in insulin resistance and impaired glucose tolerance, implying that the lin28/let-7 pathway regulates glucose metabolism [34]. [score:4]
In another study, it was reported that miRNA let-7 expression is regulated by glucose [35]. [score:4]
MiRNAs including let-7, miR-1224 and miR-2288 that correlated with glucose levels were also correlated with target mRNAs belonging to functions of carbohydrate metabolism, including ACACA, ATXN2, FASN, ESR1, FUT8, SCD, CTH, GPR39, ITGB3, MLXIPL, BCL2, RGL1, MTAP, PGM2 and SLC16A6. [score:3]
We found that the expression of let-7 family mRNA negatively correlated with GLU levels, positively correlated with erythrocytes and negatively correlated with LYM. [score:3]
The other five miRNA transcripts were identified as locally regulated SNPs associated within the same chromosome of the probe-set/gene, including miR-30e, miR-19a, let-7 g, miR-4507 and miR-27d. [score:2]
As discussed above, the let-7 family plays a significant role in glucose metabolism; this study shows the complex levels of regulation. [score:2]
Five other miR (miR-30e, miR-19a, miR-4507, miR-27d and let-7 g) were associated with SNPs on the same chromosome. [score:1]
A number of studies have also demonstrated that let-7 miRNAs levels drop after infection, which in turn increases IL-10 mRNA [36]. [score:1]
[1 to 20 of 8 sentences]
10
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
However, the mpiPSCs did not show down-regulation of most let-7 family members, including let-7c, let-7d, let-7e, let-7f, let-7g and let-7i. [score:4]
Inhibition of the let-7 family by Lin 28a, a very important pluripotent factor, improves the efficiency of somatic cell reprogramming [39]. [score:3]
The expression of the let-7 family was investigated because inhibition of the let-7 family was previously suggested to promote the reprogramming of somatic cells into piPSCs. [score:3]
MiR-98 belongs to the let-7 family and also targets MYC [38]. [score:3]
We found that most members of the let-7 family (except let-7a) were down-regulated in hpiPSCs compared with pEFs (Fig 5B). [score:3]
[1 to 20 of 5 sentences]
11
[+] score: 15
Let-7 miRNAs were differentially expressed between Tongcheng and Large White pigs, indicating the gene expression regulation at posttranscriptional level in liver is different between lean and fatty pigs at the same body weight. [score:6]
Let-7a was the most highly expressed let-7 family member, it has been confirmed as a negative regulation signal transducer and activator of transcription 3 (STAT3), which is associated to hepatocellular proliferation and hepatocarcinogenesis [45]. [score:4]
These results indicated that let-7 family members play important roles in liver development [46]. [score:2]
The rat let-7/98 family has 8 members (let-7g is not included). [score:1]
The human let-7/98 family contains 9 members, i. e., hsa-let-7a/b/c/d/e/f/g/i and hsa-miR-98. [score:1]
We found that the porcine let-7/98 family has 12 members including the 9 human homologous and ssc-let-7h/j/k miRNAs (Table S16). [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 14
Let-7a inhibits cell growth and tumor formation [33], while let-7f inhibits the invasive and metastatic potency of gastric cancer lines by downregulation of MYH9 (a metastasis -associated gene) [34]. [score:8]
The let-7 family is a conserved family of miRNAs, the members of which behave as tumor suppressors [32]. [score:3]
Moreover, other miRNAs were also expressed abundantly in skeletal muscles, including ssc-let-7a, ssc-let-7c, ssc-let-7f, ssc-miR-143-3p, ssc-miR-10b, ssc-miR-148a, ssc-miR-127, ssc-miR-30d, ssc-miR-30a-5p, and ssc-miR-181a. [score:3]
[1 to 20 of 3 sentences]
13
[+] score: 12
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Some muscle miRNAs have well-defined target genes, as miR-206 regulates IGF-1; miR-1, miR-122, and miR-462 control IGF-2a; the let-7 family regulates MSTN; miR-103 and miR-107 modulate GHR and FSHR; and miR-138 and miR-211 control LHR. [score:5]
The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. [score:3]
The let-7 family is known to regulate multiple genes related to the cell cycle and proliferation (Yang et al., 2008), and let-7i was shown to influence innate immunity (Chen et al., 2007). [score:2]
The first miRNAs, lin-4 and let-7, were both discovered in Caenorhabditis elegans (Lee et al., 1993; Wightman et al., 1993; Reinhart et al., 2000) and have subsequently been found to correspond to a novel and extensive class of small non-coding RNAs (Lagos-Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001). [score:1]
A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 12
let-7 down-regulation relieved suppression of the major macrophage cytokines IL-6 and IL-10 [14, 15]. [score:6]
Schulte et al. [14] demonstrated that the let-7 family of miRNAs was down-regulated in macrophages infected with Salmonella Typhimurium or challenged with purified LPS. [score:4]
The hybridization of miR-145, miR-125b, miR-221 and miR-27b showed signals that were approximately 22 nt in size, whereas the let-7f, miR-142, miR-26a, miR-19b and miR-99a detected not only the mature form but also the approximately 75-nt precursors on the same blots (Figure 2). [score:1]
In addition to miR-146 and miR-155, the let-7, miR-15, miR-128 and miR-29a also have roles in Salmonella infection. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 11
We used no-error mapping to differentiate the single base difference in mapping mammalian let-7 -family miRNAs, and identified eight let-7 -family miRNAs besides let-7j, which were expressed throughout development in all ten libraries (Table S14) and exhibited high levels of sequence conservation in mammals (Figure S3). [score:4]
The let-7 -family miRNAs, one of the key miRNA regulators in development, are present in abundance across various species including mammals, flies, worms and plants [38]. [score:3]
The alignments of each sequenced let-7 miRNAs with the corresponding mammalian let-7 -family of miRNAs: (B) PN(a)1-1-5P (as same sequence as PN(a)1-2-5p) aligned to homologous let-7a; (C) PN(a)2-5p aligned to homologous let-7b; (D) ssc-let-7c-5p (known porcine miRNA) aligned to the corresponding miRBase ssc-let-7c; (E) PN(a)3-5p aligned to homologous let-7d; (F) PN(a)4-5p aligned to homologous let-7e; (G) ssc-let-7f-5p (known porcine miRNA) aligned to the corresponding miRBase ssc-let-7f; (H) PN(a)6-5p aligned to homologous let-7g; (I) ssc-let-7i-5p (known porcine miRNA) aligned to the corresponding miRBase ssc-let-7i. [score:1]
At present, there are nine members of the let-7 -family in mammals: let-7a to -7g, let-7i and let-7j (only identified for dog). [score:1]
The high-count miRNAs include the muscle-specific miR-1a-3p, liver-specific miR-122-5p, and the ubiquitous let-7 -family miRNAs. [score:1]
Figure S3Sequence alignments of the sequenced let-7 -family miRNAs and the homologous mammalian let-7 family miRNAs. [score:1]
[1 to 20 of 6 sentences]
16
[+] score: 10
Some myogenesis related miRNAs (miR-133, miR-1, miR-206 and miR-148a) are highly abundant in MS pigs, while other miRNAs (let-7 family, miR-214, miR-181) highly expressed in LW. [score:3]
Interestingly, Among them, miR-133, miR-1, miR-206 and miR-148a were highly abundant in MS pigs, while let-7 family, miR-214 and miR-181 were highly expressed in LW. [score:3]
Let-7a, let-7c and let-7i (members of let-7 family) are regulators in development, and in cellular basal metabolism [30]. [score:3]
The let-7 family of microRNAs. [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
18
[+] score: 10
The expression pattern of the Let-7 gene family is another conflicting result since the expression of the Let-7 gene family was undetected in this study, while previously it accounted for 7.7% of the total miRNA expression in pig fat [30]. [score:7]
On the other hand, some miRNAs were also reported as inhibitors of adipocyte differentiation, such as miR-27b and let-7 [12, 13]. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 9
PTr2 expressed all 14 miRNAs and miR-16, miR-17-5P, miR-15b, let-7f, and miR-20a were found in greater abundance (Fig. 4a). [score:3]
In PTr2 cells, miR-16, miR-17-5P, miR-15b, let-7f, and miR-20a were relatively abundant. [score:1]
miR-155-5P, miR-221-5P, let-7f, and miR-181c-1 were either absent or not detectable in the samples. [score:1]
Among these, miR-16, miR-17-5P, let-7f, miR-126-5P, and miR-296-5P were relatively abundant (Fig. 4b). [score:1]
Among these, miR-16, miR-17-5P, let-7f, miR-126-5P, and miR-296-5P were relatively abundant. [score:1]
miR-155-5P, miR-221-5P, let-7f, and miR-181c-1 were either absent or not detectable in our samples (Fig. 4d). [score:1]
However, a few miRNAs such as miR-155, miR-221, let-7f, miR-181C-1 were not detected in the EVs released by PAOEC and we are unable to speculate about their absence. [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 9
Whereas, overexpression of let-7 [9], miR-27b [8] and miR-448 [7] inhibits 3T3-L1 adipogenesis by targeting HMGA2 (high-mobility group AT-hook 2), PPARγ and klf5 (kruppel-like factor 5), respectively. [score:7]
1742-4658.2009.06967. x 19348006 9. Sun T. Fu M. Bookout A. L. Kliewer S. A. Mangelsdorf D. J. Microrna let-7 regulates 3t3-l1 adipogenesis Mol. [score:2]
[1 to 20 of 2 sentences]
21
[+] score: 8
According to the high-throughput sequencing data, the let-7 family (let-7a, let-7f, let-7 g), the miR-10 family (miR-10b, miR-10a-3p, miR-10a-5p), miR-21, miR-143-3p, miR-30a-5p, miR-16 and miR-192 had the highest expression levels among the 10 expression profiles (Additional file  1: Figure S3), which suggests that these miRNAs are highly conserved among different organs in the same species. [score:5]
The first miRNA to be discovered was let-7, which was identified in 2001 in C. elegans. [score:1]
For example, ssc-let-7a, ssc-let-7c, ssc-let-7f, ssc-let-7 g and ssc-let-7i from the let-7 family and ssc-miR-21 maintained high transcription levels in all samples, which is consistent with previous findings [23] (Additional file  1: Figure S3). [score:1]
To verify the accuracy of the high-throughput sequencing results, stem-loop quantitative (q)RT-PCR was performed on 12 significantly DE miRNAs (ssc-miR-10b, ssc-miR-486, ssc-miR-24-3p, ssc-miR-195, ssc-miR-19b, ssc-let-7f, ssc-miR-146b, ssc-miR-novel-chr16_17559, ssc-miR-novel-GL892871-2_41708, ssc-miR-novel-chr2_21624, ssc-miR-novel-chr12_7961, and ssc-miR-26a). [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 2 sentences]
23
[+] score: 7
As a positive control, the expression level of cellular microRNA let-7f was decreased after four of the cellular genes knockdown (Figure 6B left, 6D left). [score:4]
Relative expression levels of cellular genes Drosha/Dicer/Ago2/RNase L, let-7f and PRRSV-vsRNA1 at 12 hpi after GD-HD A, B. or CH-1a C, D. infection were determined by qRT-PCR. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 7
The small RNA sequencing data showed the upregulation of the miR-302b/367 and miR-106a/363 clusters, and downregulation of let-7 family members and the miR-17/92 cluster. [score:7]
[1 to 20 of 1 sentences]
25
[+] score: 6
Ssc-let-7a, ssc-let-7f, ssc-let-7c were highly expressed throughout prenatal and postnatal development in our study. [score:4]
Aside from ssc-miR-206 and ssc-miR-1, ssc-miR-378 was the most abundant at E90, followed by ssc-miR-143-3p, ssc-let-7a, ssc-let-7f, ssc-let-7c, ssc-miR-30d, ssc-miR-30a-5p, ssc-miR-10b, ssc-miR-127, ssc-miR-148a, ssc-miR-126, ssc-miR-7i, and ssc-miR-21. [score:1]
The ssc-let-7 family is a conserved family of miRNAs. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 6
This is consistent with previous reports that ssc-let-7 is highly expressed in various cell types and species [22]. [score:3]
Among the 15 most abundant miRNAs, the most strongly expressed miRNA in both libraries was ssc-let-7 (f, a, d, e, g, c), which represented 74.98% and 74.39% of the total miRNA reads in two samples, respectively. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 5
The most abundant identified miRNA was miR-21, followed by two members of the let-7 family (ssc-let-7f, ssc-let-7c) known to be the most abundantly expressed in higher eukaryotes. [score:3]
let-7, miR-21 and others) [40], [41]. [score:1]
For example, only six members of Let-7 miRNA family are currently annotated for the pig (miRBase, release 16), however by comparative analysis of porcine sequence tags with human miRNAs all the eleven members of this miRNA family could be identified by the present study. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 5
Seven key miRNAs including let-7f, miR-125b, miR-133a, miR-199a, miR-200b, miR-200c and miR-455 are highly expressed in the mesenchyme or epithelium of different tooth development stages, but their functions have not been elucidated [6], [8]. [score:4]
Comprehensive consideration of the signal intensity (signal≥500) (Table S6) let to the prediction of 18 key miRNAs, including let-7f, miR-128, miR-200b, and miR-200c (Table 1). [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 5
To gain insight into the general functions of miRNAs in the pituitary, the 10 most abundant miRNAs, except for the let-7 family that is well known to be ubiquitously expressed, were selected for predicting target genes and classified according to KEGG functional annotation using DAVID bioinformatics resources [33]. [score:5]
[1 to 20 of 1 sentences]
30
[+] score: 5
The porcine ZNF265 3′ UTR contains a putative target site for miR-139-5p, whereas the porcine RGS16 3′ UTR was predicted to have a single site targeted by the let-7 miRNA family members let-7b-5p, let-7c and let-7e (Table  2). [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
Members of the let-7 family are broadly considered to be tumour suppressors, downregulating several oncogenes including KRAS [18]. [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 3
The microarray data showed that several microRNAs including let-7, miR-923, miR-202, miR-21 and miR-145 were highly expressed in the porcine testes (Table S2). [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
The let-7 family miRNAs were all highly expressed in RX_J and RX_Y libraries. [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
One such newly identified miRNA, named let-7f-2 (a member of let-7f family), is shown in Figure 1D. [score:1]
Several miRNAs (i. e., let-7f, miR-21, miR-140, miR-185, miR-320, miR-423, miR-2476-1, miR-2476-2 and miR-2476-3) are indicated with arrows. [score:1]
Top: the predicted secondary structure of let-7f-2; bottom: the distribution of sRNA reads across its hairpin. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 3
Among them, ssc-let-7f, which is derived from the let-7 -family, and the ssc-miR-21 had the highest expression level, and this result is consistent with previous studies [19]. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
, 32 miRNAs, including let-7b, let-7d and let-7i from the let-7 family, were differentially expressed during myogenesis. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
We found that 13 miRNAs (ssc-miR-10b, -21, -26a, -99a, -126-3p, -143-3p, -148a-3p, -199a-3p, -199b-3p, -let-7i, -let-7g, -let-7f, and -let-7a) were highly expressed in both subcutaneous and abdominal adipose tissues from deep sequencing. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Several miRNAs such as let-7, miR-27 and miR-103 are reported to perform very important functions in adipogenesis [33]– [35]. [score:1]
Obviously, high-abundant miRNAs (let-7c, let-7f, miR-148a, miR-21 and miR-24) had higher edited probability in backfat tissue. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 2
The discovery of the regulatory miRNA let-7 in C. elegans in 2000 [10], with homologs in other species including humans, caused researchers to reconsider the idea that miRNAs may have a more widespread function within cells. [score:2]
[1 to 20 of 1 sentences]
41
[+] score: 2
Overall, miR were lowly abundant throughout fetal development with the exception of let-7 and muscle specific miR-1 and miR-206. [score:2]
[1 to 20 of 1 sentences]
42
[+] score: 1
Matching of the miRNA’s nt 13–17 can compensate for a single-nucleotide bulge or mismatch in the seed region, as illustrated by the experimentally validated let-7 sites in LIN41 [34] and the miR-196 site in HOXB8 [35]. [score:1]
[1 to 20 of 1 sentences]
43
[+] score: 1
Luo et al. previously performed a sensitivity test of the microarray using the artificially transcribed miRNA of let-7a to hybridize to the let-7 probe set (let-7a to let-7g, let7-i). [score:1]
[1 to 20 of 1 sentences]
44
[+] score: 1
Furthermore, miRNAs such as let-7 and members of the miR-290 cluster influence the early stages of gametogenesis, namely, primordial germ cell specification and migration [12], [13]. [score:1]
[1 to 20 of 1 sentences]
45
[+] score: 1
Several miRNAs previously reported to be involved in immune response such as miR-21, miR-125a, miR-99b, miR-146a and let-7 families were identified. [score:1]
[1 to 20 of 1 sentences]
46
[+] score: 1
569 AMP miR-10, miR-126, let-7, miR-27, miR-450 9.860E-05–5.804E-04 0.789–0.730 ADP miR-15, miR-885, miR-322, miR-450, miR-338 1.316E-04–4.540E-03 0.781–0.636 ATP miR-15, miR-450, miR-210, miR-885, miR-451 4.811E-04–9.562E-03 0.737–0.593 Correlations between gene expression derived from post quality-filtered 17,820 mRNA probes and each phenotypic- trait were calculated for both Duroc and PiNN pigs. [score:1]
[1 to 20 of 1 sentences]