sort by

7 publications mentioning ptc-MIR482d

Open access articles that are associated with the species Populus trichocarpa and mention the gene name MIR482d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 173
For example, there were 10 NBS-LRR target genes targeted by miR482.2 while only 1 NBS-LRR gene, POPTR_0019s00620.1, remained as the solemn target gene of miR1448 in poplars (Table S1). [score:7]
For the four nucleotide mutations that occurred in the mature sequence of miR1448 when compared to miR482.2, poplar miR1448 lost the control of most of the target genes (miR482.2 targeted 12 NBS-LRR protein-coding genes while miR1448 only targeted 1 NBS-LRR gene). [score:7]
0047811.g006 Figure 6 For the four nucleotide mutations that occurred in the mature sequence of miR1448 when compared to miR482.2, poplar miR1448 lost the control of most of the target genes (miR482.2 targeted 12 NBS-LRR protein-coding genes while miR1448 only targeted 1 NBS-LRR gene). [score:7]
However, the expression of miR1448 is upregulated by at least 1.5 times whereas miR482.2 in poplar remains unchanged under mechanical stress [6]. [score:6]
Functional analysis of target genes revealed that the major role of miR482 was in resistance to disease or other stresses via NBS-LRR proteins, whereas the biological functions of miR1448 are more diverse. [score:5]
However, what caused these differential expression patterns in miR482.2 and miR1448 miRNAs?Differ from the mRNAs that encoding proteins, another maturation process was needed before the pre-miRNAs mediated gene expression at the post-transcription level. [score:5]
MiR482 was ubiquitously distributed in many plants and it also targeted some NBS-LRR protein-encoding genes by target their P-loop motifs [8]. [score:4]
Moreover, one study revealed that the tertiary structure of the internal regions in miRNAs polycistron might autoregulate the mature efficiency of the individual miRNAs in difference tissues [15], therefore, the expression level of miR482.2 and miR1448 might also influenced by the tertiary structure of their internal region. [score:4]
Expression patterns of the MIR482 and MIR1448 genesAccumulating evidence suggests that some clustered MIRNAs in plants and animals are cotranscribed together as a polycistron [1], [9], [29], [30], [31]. [score:3]
As the integral component in protein synthesis, rDNA had a more significant role than the MIRNA genes (MIR482 and MIR1448) involved in poplar disease resistance or other stresses at the post-transcriptional level. [score:3]
For example, the expression level of both miR482.2 and miR1448 decrease under cold, heat, and dehydration stresses, and remain stable under salt stress in P. trichocarpa [6]. [score:3]
This may be the reason for the different expression patterns of the MIR482 and MIR1448 under certain stresses. [score:3]
Expression patterns of the MIR482 and MIR1448 genes. [score:3]
Table S1 The target genes of miR482 and miR1448 in Populus trichocarpa. [score:3]
Therefore, it was very likely that poplar miR482.2 (with a 5′U) and miR1448 (with a 5′C) might associate with different argonaute proteins, and these two pre-miRNAs might be differentially expressed for their different mature efficiency. [score:3]
With regard to plant ABC transporter proteins associated with polar auxin transport, lipid catabolism, xenobiotic detoxification, disease resistance, and stomatal function [28], this implies that miR1448 might be more significant than miR482.2 in responses to environmental change. [score:3]
Mature sequences of miR482.2 and miR1448 both target the sequences encoding the “MGGV(L)GK” peptide in the NB-ARC domain of some NBS-LRR resistance proteins (Figure 6, Table S1). [score:3]
We also found that miR1448 and miR482 genes were both located in 12 expression sequence tags (ESTs) of approximately 600 base pairs (bp) in length from four poplar species or hybrids. [score:3]
Interestingly, we recently identified another disease resistance-related miRNA, miR482, clustered with miR1448 in a narrow region (272 nt) of the poplar chromosome LG_VIII in the preliminary study of this research. [score:3]
However, what caused these differential expression patterns in miR482.2 and miR1448 miRNAs? [score:3]
To verify this hypothesis, and to reveal the potential evolutionary mechanism of MIR1448, we considered a phylogenetic analysis of plant MIR482, the thermodynamic stability of its secondary structure, nucleotide substitution mo dels, a compensatory substitution mo del for the stem region, and the possible expression patterns of the MIR482 and MIR1448 genes. [score:2]
This substitution pattern suggests that compensatory mutations could be the evolutionary mechanism of MIR482 and MIR1448, as in some primate miRNA genes [18] and other functional RNA genes [19], [20]. [score:2]
The MIR482-MIR1448 polycistron is specific to plants in the family Salicaceae. [score:1]
LOGO representation of the secondary structure demonstrated that nucleotide substitution occurred at one site in the upper stem region (the mature miRNA-miRNA* secondary structure) of pre-miR482, but occurred at four sites in the lower stem region of Populus (the RNA-duplex structure adjacent to the mature miRNA-miRNA* stem) (Figure 3A). [score:1]
The mature miR482.2 and mature miR1448 in the genera Salix, Populus, and Idesia were identical, being 5′UCUUGCCUACUCCUCCCAUU3′ and 5′CUUUCCAACGCCUCCCAUAC 3′, respectively. [score:1]
Text S2 The pre-miR482 and miR482 sequences in miRBase release 18. [score:1]
The mature sequences of miR482.2 and miR1448 were highlighted in light blue. [score:1]
0047811.g004 Figure 4The tertiary structure of miR482-miR1448 polycistron in Populus trichocarpa. [score:1]
The minimum free energy (MFE) analysis indicated that the stability of the secondary structure of pre-miR1448 in both Populus and Salix was −42.6±1.75 kcal/mole and that of pre-miR482 was −45.3±2.12 kcal/mole (two-tailed t-test, not statistically significant at the 5% level). [score:1]
The MFE structure of poplar MIR482-MIR1448 polycistrons were predicted in this study. [score:1]
We constructed three NJ trees based on the combined data from the MIR482-MIR1448 polycistron (not including the 5′ upstream sequence before −92 nt from the pre-miR482), rDNA-ITS and MIR482-MIR1448-ITS data, respectively. [score:1]
This led to the question of whether the MIR482-MIR1448 polycistron (the single-copy in the poplar genome) would be beneficial for taxonomic purposes in poplars. [score:1]
Moreover, with the exception of poplars, none of the MIR482-MIR1448 homologous sequences or miR482-related polycistron was derived from the NCBI EST database and genome database of other plant species. [score:1]
For the MIR482-MIR1448 polycistron, the pre-miR482 and pre-miR1448 sequences were the functional region, while 5′ and 3′ flanking sequences of the MIR482-MIR482 polycistron and internal regions between pre-miR482 and pre-miR1448 sequences were the non-functional regions. [score:1]
Finally, the EST or WGS sequence contained miR482-related polycistron was determined according to two criterions: 1), at least one pre-miR482 and one homologous region of this pre-miRNA (the p-distance of these two homologous region was not more 0.40 which determined according to the distance of ptc-pre-miR482 and ptc-pre-miR1448) clustered in one EST sequences, or pre-miR482 and its homologous region was found in a region that not more than 2000 nt in WGS sequence; 2), the homologous region of this pre-miRNA satisfied with the other criterions that used for plant miRNAs predication [36]. [score:1]
0047811.g003 Figure 3The stem-loop structure and thermodynamic stability of the pre-miR482 and pre-miR1448 in Populus. [score:1]
Neighbor-joining phylogenetic trees based on the MIR482-MIR1448 polycistron and rDNA-ITS combined dataset in Populus. [score:1]
Secondary structure and thermodynamic profiling of the MIR482 and MIR1448 genes. [score:1]
Influenced by nucleotide substitution that occurred at the neighbor nucleotide sites, the thermodynamic profiling of the specific sites (positions 42 and 43 in miR482.2 and positions 34 and 36 in miR1448; see Figure 3) in the lower stem region of the pre-miRNA structure varied among different plants. [score:1]
Both pre-miR482 and pre-miR1448 were highly conserved in Populus and Salix, and the nucleotide divergence was 0.0206 and 0.0269 (p-distance), respectively. [score:1]
0047811.g005 Figure 5Neighbor-joining phylogenetic trees based on the MIR482-MIR1448 polycistron and rDNA-ITS combined dataset in Populus. [score:1]
MIR1448 is the tandem duplicate product of MIR482 in Salicaceae. [score:1]
0047811.g002 Figure 2The nucleotide sequences of miR482 and miR1448 in Populus in the miRNA:miRNA* duplex. [score:1]
The substitution ratio of the MIR482-MIR1448 polycistron and rDNA-ITS regions. [score:1]
Substitutions observed in pre-miR482 and pre-miR1448 in Populus, on the basis of the secondary structure of Populus alba clone P01. [score:1]
The more homologous relationship between miR1448 and miR482.2 is discussed below. [score:1]
Substitution ratio of the MIR482-MIR1448 polycistrons and rDNA-ITS regions. [score:1]
Origin and evolutionary patterns of the MIR482 and MIR1448 genes of Populus In recent years, several mo dels of the origin of MIRNA genes have been proposed. [score:1]
Except for the internal regions of the MIR482-MIR1448 polycistron, the substitution ratios of the functional regions of the MIRNAs were significantly lower than those of the non-functional regions (P value <0.0001, two-tailed t-test) (Table 2). [score:1]
In a previous study, we also found that miR1448 but not miR482.2 was responsive to fungal pathogen stress in the bark of poplar (unpublished data). [score:1]
The pre-miR482 sequences were 107 nt and 109 nt in length in Populus and Salix, respectively. [score:1]
Detection of the MIR482-related polycistron in other plants. [score:1]
To examine whether the miR482-related polycistron was ubiquitously distributed in plants or only was specifically distributed in Salicaceae, the Blast analysis were conducted in the EST and WGS (whole-genome shotgun contigs) database of NCBI using every pre-miR482 sequences of the other plants. [score:1]
Single substitutions, P<0.0001 for MIR482; P<0.05 for MIR1448 (two-tailed Fisher's exact test). [score:1]
The MFE structure prediction used RNAstructure v5.3 showed that the pre-miR482 and pre-miR1448 could form a stem-loop structure, meanwhile, the internal region in miR482-miR1448 polycistron also could fold back on itself to form a helix. [score:1]
In addition, the paralog genes of MIR482 in some specific species (such as MIR482a, − b, − c and − d in loblolly pine) are the products of one or two gene duplication events after the species formed. [score:1]
In a similar manner, we suggest that MIR1448 originated from MIR482 through tandem replication events in Salicaceae. [score:1]
LOGO representation indicated that nucleotide sequences in the miRNA:miRNA* duplex between miR482.2 and miR1448 were highly conserved. [score:1]
For example, 15 nucleotide sites were identical in miR482.2 and miR1448, while 13 were identical in miR482.2* and miR1448* (Figure 2). [score:1]
These results imply that the clustered MIR482-MIR1448 genes are family-specific miRNA genes found only in Salicaceae. [score:1]
To determine the difference in the nucleotide substitution ratio (Kimura 2-parameter) of different regions of these two miRNA genes, the functional and nonfunctional regions were identified in both the MIR482-MIR1448 polycistrons and rDNA-ITS sequences. [score:1]
For example, the length of pre-miR482 varied from 69 to 179 nt (pre-miR482b of soybean and pre-miR482a of Aquilegia, respectively) and the average distance (p-distance) was as high as 0.401. [score:1]
Figure S1 The alignment of miR482-miR1448 polycistron in Salicaceae. [score:1]
And then, companied with the tandem repeated sequence of the queried pre-miR482, the derived ESTs and/or partial WGS nucleotide sequences were alignmented in MUSCLE [35]. [score:1]
MIR482 is a highly diverse miRNA gene that is ubiquitously distributed in gymnosperm, monocot, and dicot plants. [score:1]
Additionally, PCR amplification and Blast analysis demonstrated the MIR482-MIR1448 polycistron structure is only existed in Salicaceae plants. [score:1]
The substitution ratio in the functional region of rDNA (0.0026) was only 20% of the pre-miRNAs (mean value 0.0155) (Table 2), suggesting that rDNAs were under stronger functional constraints than the MIR482 and MIR1448 genes. [score:1]
NCBI-EST-Blast also revealed that the whole sequence of pre-miR482 and pre-miR1448 were simultaneously contained in one EST sequence. [score:1]
By comparing the pre-miR482, pre-miR1448, and the mature sequences of miR482 and miR1448 in P. trichocarpa, we identified the precursors and mature sequences of miR482 and miR1448 in Salicaceae (poplar pre-miR482 produced two mature miRNAs, miR482.1 and miR482.2, which shared 15 overlapping nucleotides). [score:1]
Similar to the other protein-coding genes, the upstream sequences of the MIR482-MIR1448 polycistron consisted of some AT-rich regions. [score:1]
Secondary structure and thermodynamic profiling of the MIR482 and MIR1448 genesThe precursor and mature sequences of miR482.2 and miR1448 were determined for the highly homologous MIR482-MIR1448 polycistron in Populus and Salix, according to the aligned results. [score:1]
To determine the phylogeny of the MIR482 gene, we derived all precursor and mature sequences of plant miR482 (Text S2) from miRBase release 18 (http://www. [score:1]
Although miR1448 was shown to be homologous to miR482, miR1448 acquired some related but not identical functions after a long evolutionary process. [score:1]
In the present study, based on the phylogenetic analysis of the MIR482 and MIR1448 genes, we assumed that MIR482 was an “old miRNA” gene in seed plants and that MIR1448 was a “young miRNA” gene in Salicaceae. [score:1]
The precursor and mature sequences of miR482.2 and miR1448 were determined for the highly homologous MIR482-MIR1448 polycistron in Populus and Salix, according to the aligned results. [score:1]
The phylogenetic analysis (Figure 1) also suggested that pre-miR1448 sequences in P. trichocarpa were homologous to pre-miR482 sequences not only in P. trichocarpa but also in other plants. [score:1]
MIR1448 is the tandem duplicate product of MIR482 in SalicaceaeThe phylogenetic analysis (Figure 1) also suggested that pre-miR1448 sequences in P. trichocarpa were homologous to pre-miR482 sequences not only in P. trichocarpa but also in other plants. [score:1]
The three phylogenetic trees could reveal the difference of the species in Populus sections Leuce, Turanga, and Leucoides, but could not distinguish the species in sections Tacamahaca and Aigeiros (the NJ phylogentic tree based on MIR482-MIR1448-ITS data see Figure 5). [score:1]
There was no difference in the substitution ratio between pre-miR482 and pre-miR1448. [score:1]
However, the mechanisms in Populus that drove the “duplicated miR482” evolve to miR1448 is still not clear. [score:1]
The results of the phylogenetic analysis (Figure 1) indicate that MIR482 is an “old miRNA” gene [7], and its formation in plants predates the split of gymnosperms and angiosperms (∼300 million years ago) [11]. [score:1]
Substantial diversity was found in the nucleotide sequences of pre-miR482 within the plants. [score:1]
In conclusion, we found that the poplar MIR1448 gene is a tandem duplication product of the MIR482 gene. [score:1]
From the results presented above, we inferred that the MIR1448 gene was produced by tandem replication of the MIR482 gene, and that this replication event might occurred predated the split of the Salicaceae family (∼60 to 65 million years ago) [12]. [score:1]
Therefore, only one mature miRNA, either miR482.1 or miR482.2, can be produced in poplar at any given time. [score:1]
Therefore, we assumed the MIR482-MIR1448 internal region was not only the union of the two precursors, but with some crucial role in miRNA maturation. [score:1]
Though miR482 was not reported in Arabidopsis thaliana, one study showed that miR472 is related to miR482 [8], therefore ath-pre-miR472 was also used to detect miRNAs polycistron structure. [score:1]
This leads to a discussion of what mechanisms drove the evolution of replicated MIR482 into MIR1448. [score:1]
Thermodynamic profiling of the secondary structure showed that the upper stem of both pre-miR482 and pre-miR1448 had a lower free energy than the lower stem of both pre-miR482 and pre-miR1448. [score:1]
MIR482 is a highly diverse miRNA gene that is ubiquitously distributed in gymnosperm, monocot, and dicot plantsThe mature sequences and their corresponding precursor sequences of the total 31 MIR482 gene that distributed in 16 gymnosperm, dicot, and monocot plants were derived from miRBase release 18. [score:1]
In addition, some deletions of long DNA fragments (∼240 nt) always appeared in the upstream sequences of the MIR482-MIR1448 polycistron from the various different species, and even from within the same species. [score:1]
To compare the evolutionary rate in the secondary structures of pre-miR482 and pre-miR1448, the mo del of compensatory substitutions in the stem region of pre-miRNAs was analyzed. [score:1]
The tertiary structure of miR482-miR1448 polycistron in Populus trichocarpa. [score:1]
Neighbor-joining phylogenetic tree of pre-miR482 sequences in seed plants obtained from MEGA 5.0.. [score:1]
Therefore, we hypothesized that poplar MIR1448 might have evolved from MIR482 through tandem duplication events. [score:1]
Amplification of the MIR482-MIR1448 polycistron and rDNA-ITS sequences in Salicaceae. [score:1]
Type of substitution MIR482 MIR1448 No. [score:1]
Secondary structure prediction and thermodynamic profiles of pre-miR482, pre-miR1448 in Salicaceae. [score:1]
The pre-miR482 sequences were subjected to multiple sequence alignment using MUSCLE. [score:1]
Text S1 12 poplar EST sequences contain miR482-miR1448 polycistron. [score:1]
The stem-loop structure and thermodynamic stability of the pre-miR482 and pre-miR1448 in Populus. [score:1]
Phylogenetic analysis of plant MIR482 genes. [score:1]
The mature sequences and their corresponding precursor sequences of the total 31 MIR482 gene that distributed in 16 gymnosperm, dicot, and monocot plants were derived from miRBase release 18. [score:1]
The pre-miR482 and the pre-miR1448 in both Populus and Salix could form the classic stem-loop structures that closely resemble the secondary structures of pre-miR482 and pre-miR1448 in P. trichocarpa respectively [6], [13] (Figure 3). [score:1]
The nucleotide sequences of miR482 and miR1448 in Populus in the miRNA:miRNA* duplex. [score:1]
It should be noted that, consistent with strong functional constraints on miRNA secondary structures, the general secondary structures (hairpin and loop structures) are highly conserved in all MIR482 and MIR1448 genes in Populus, as reflected by the excess of compensatory substitutions over those expected on a purely random basis (Table 3) (single substitutions, significance for MIR482 at the 0.01% level and significance for MIR1448 at the 5% level, two-tailed Fisher's exact test). [score:1]
Substitution ratio of the MIR482-MIR1448 polycistrons and rDNA-ITS regionsTo determine the difference in the nucleotide substitution ratio (Kimura 2-parameter) of different regions of these two miRNA genes, the functional and nonfunctional regions were identified in both the MIR482-MIR1448 polycistrons and rDNA-ITS sequences. [score:1]
Origin and evolutionary patterns of the MIR482 and MIR1448 genes of Populus. [score:1]
The pre-miR482 can splice into two miRNAs with a 15nt overlapping region: miR482.1 and miR482.2 [6], [13]. [score:1]
This confirms that there is a MIR482-MIR1448 polycistron [9], [10] in poplars. [score:1]
[1 to 20 of 110 sentences]
2
[+] score: 17
Additionally, it was reported that the expression level of tomato (Solanum lycopersicum) miR482 suppressed at 4 h after inoculation by bacterial (Pto DC3000 and hrcC) or viral pathogens, while the expression level of their target genes (Nucleotide Binding Site–Leucine-Rich Repeats proteins coding zgenes, NBS-LRR protein coding genes) increased [16]. [score:9]
We noticed that one newly study revealed that the expression of tomato miR482, that targeted some NBS-LRR protein genes, suppressed after inoculation by bacteria and virus pathogens [16]. [score:7]
2. For miR482 located on the 187bp before the mature sequence of miR1448 in P. trichocarpa LG_VIII, the promoter analysis of miR1448 was undertaken on the up-stream of pre-miR482 (2500bp in length). [score:1]
[1 to 20 of 3 sentences]
3
[+] score: 8
Other miRNAs from this paper: ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR394a, ptc-MIR394b, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR403a, ptc-MIR408, ptc-MIR472a, ptc-MIR472b, ptc-MIR482a, ptc-MIR171k, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1444a, ptc-MIR1444b, ptc-MIR1444c, ptc-MIR1446a, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c, ptc-MIR1444d, ptc-MIR1444e
Four UDPGs were found to be targeted by Ptc-miR482, and all were classified as category I. The UDP-glucosyltransferases (UDPGs) are enzymes that attach a sugar molecule to a specific acceptor in plants [68]. [score:3]
5MYB4Ptc-miR397cPOPTR_0002s01740.1III1351633.5PETE1 (plastocyanin 1)Ptc-miR397cPOPTR_0009s05960.1III16601044HydrolasePtc-miR398a POPTR_0010s06990.1/2III14283464DC1 domain-containingPtc-miR473aPOPTR_0602s00210.1I8503274VEP1 (vein patterning 1)Ptc-miR475dPOPTR_0003s20310.1/3I18985444Zinc finger (CCCH-type) family proteinPtc-miR476aPOPTR_0001s21140.1III1451373.5Post-illumination chlorophyll      Fluorescence increase proteinPtc-miR403a-c POPTR_0016s03150.1III6371564Cytochrome p450Ptc-miR403a-c POPTR_0016s03160.1III6341564Cytochrome p450Ptc-miR482.1POPTR_0017s06100.1I124713123.5UDP-glucosyl transferasePtc-miR482.1POPTR_0009s13280.1III1036944Translation initiation factorPtc-miR482.1POPTR_0010s13860.1III1521014ATP -dependent Clp protease      Adaptor proteinPtc-miR482.1POPTR_0017s06080.1I91413123.5UDP-glucosyl transferasePtc-miR482.1POPTR_0322s00200.1I124713123.5UDP-glucosyl transferasePtc-miR482.1POPTR_0017s06120.1I101013123.5UDP-glucosyl transferasePtc-miR482.1POPTR_0001s27260.1III10331443.5Carotenoid cleavage dioxygenase 1Ptc-miR482.1POPTR_0009s06530.1III10511444Carotenoid cleavage dioxygenase 1Ptc-miR482. [score:3]
This is a novel mechanism by which miR482 regulates the UDPG gene family in P. trichocarpa. [score:2]
[1 to 20 of 3 sentences]
4
[+] score: 6
We also performed a search for predicted genomic target sites of miR390, miR475, miR476, miR482.2, and miR828 to examine whether any predicted targets matched the location of identified phased loci. [score:5]
We included miR482.2 because it potentially sets the phase of the locus identified on LG_X:19646453.. [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 5
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
Based on these target requirements, we cannot find any targets for three miRBase 8.2 miRNA genes: ath-MIR416, ptc-MIR482, and osa-MIR438. [score:5]
[1 to 20 of 1 sentences]
6
[+] score: 3
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
It includes pde-miR159a, pde-miR169a, pde-miR396a, pde-miR482c, pde-miR482d, pde-miR949a, pde-miR950a, pde-miR952a, pde-miR952b, pde-miR952c, pde-miR1313, pde-miR1314a, pde-miR1448, pde-miR2118a, pde-miR2118b, pde-miR3701, pde-miR3704a, pde-miR3704b and pde-miR3712 (Table 1), of which 17 miRNAs were further validated by subcloning and sequencing except pde-miR396a and pde-miR482c. [score:1]
Singletons3959581 was also predicted containing precursor sequences of 3 miRNAs, pde-miR482d, pde-miR1448 and pde-miR2118a. [score:1]
For example, the pde-MIR482 family has 4 members, whereas only one exists in 19 miRNA families (pde-MIR159, pde-MIR162, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR783, pde-MIR946, pde-MIR947, pde-MIR950, pde-MIR951, pde-MIR1310, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR1448, pde-MIR3701 and pde-MIR3712). [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2). [score:1]
[1 to 20 of 1 sentences]