sort by

17 publications mentioning gma-MIR408c

Open access articles that are associated with the species Glycine max and mention the gene name MIR408c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 40
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR164a, gma-MIR167c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR4403, gma-MIR171c, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR1535b, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5037b, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169m, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR319n, gma-MIR171p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR6300, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
As shown in Figures 1, S1 and S2, miRNA397a, miRNA408 and miRNA398c all showed significantly up-regulated in both HX3 and ZH24, meanwhile their corresponding targets, Glyma18g42520.1, Glyma03g26060.2, Glyma08g13510.1 Glyma14g39910.1 and Glyma06g19680.2 (Figures 4 and 5), showed apparently down-regulated alteration in the two cultivars. [score:9]
Under Cd stress, miR397, miR408 and miR398 were reported to be up-regulated and miRNA396 and miRNA319 to be down-regulated in response to Cd exposure in the root of rice or Brassica [25], [26]. [score:7]
In this study, miR397a, miR408 and miRNA398c showed almost the similar up-regulated alteration to response to Cd exposure, which might imply that SPL7 involved in regulation of Cu deficiency and Cd response in soybean (Figures 1, S1 and S2). [score:5]
To investigate whether the target genes detected by the degradome sequencing were actually regulated by Cd-responsive miRNAs, the expression levels of ten targets (Glyma18g42520.1, Glyma03g26060.2, Glyma08g13510.1, Glyma14g39910.1, Glyma06g19680.1, Glyma18g03980.2, Glyma15g19460.1, Glyma17g35090.1, Glyma03g38120.1 and Glyma19g40720.1) of six Cd-responsive miRNAs (gma-miR397a, gma-miR408, gma-miR398c, gma-miR1509b, gma-miR396b-5p and Vun78330_1521_100) were measured in Cd tolerant (HX3) and Cd sensitive (ZH24) soybean roots exposed to 22 μM Cd with a mixture of samples from 6 h to 144 h by using qRT-PCR (Figures 4 and 5). [score:4]
Among the 26 miRNAs, 14 miRNAs (gma-miR3522, gso-miR3522a, gso-miR3522b, gma-miR397a, PN-miR397a_L-1, ahy-miR408-3p, gma-miR408, gma-miR408b-5p, gma-miR4996, gma-miR396a-3p, gma-miR396i-3p, ahy-miR398, gma-miR398a and gma-miR398c) belonging to six families were up-regulated by Cd exposure (P<0.01) in both HX3 and ZH24. [score:4]
In addition, SPL7 is required for the expression regulation of other Cu-related miRNAs such as miR397, miR408, and miR857 [56]. [score:4]
MiRNA397a and miRNA408 are two other important Cd-responsive miRNAs, which are also regulated by SPL7. [score:2]
To validate the expression profile of the soybean miRNAs obtained through the microarray assays, qRT-PCR was performed for 16 Cd-responsive miRNAs (gma-miR3522, gma-miR397a, gma-miR408, gma-miR408b-5p, gma-miR4996, gma-miR396a-3p, gma-miR398c, gma-miR1509b, gma-miR5037b, PC-15-5p, gma-miR319c, gma-miR1535b, Gma-m040-5p, gma-miR4403, gma-miR396b-5p, and Vun78330_1521_100) in the same samples used in the microarray (Figure S1 and S2). [score:2]
In addition, miRNA408 was identified to cleaved cupredoxin, laccase and plantacynin by degradome sequencing. [score:1]
In this study, a total of 26 Cd-responsive miRNAs were identified; almost half of which, such as gma-miR397a, PN-miR397a_L-1, ahy-miR408-3p, gma-miR408b-5p, gma-miR408b-5p, gma-miR396b-5p, ahy-miR398, gma-miR398a, gma-miR398c, vun-miR319b, gma-miR319c and Vun78330_1521_100, have the similar alteration patterns in HX3 and ZH24 as that of rice and Brassica mentioned above (Table 1 and Figure 1). [score:1]
Ding et al. [25] verified that miR166, miR171, miR390, miR156 and miR168 responded to Cd stress in rice, and Zhou et al. [26] reported that miR396, miR397, miR398 and miR408 were related to Cd exposure in Brassica. [score:1]
[1 to 20 of 11 sentences]
[+] score: 27
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1520d, gma-MIR167d, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4348a, gma-MIR4361, gma-MIR4368b, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4414a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171e, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR862a, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR167i, gma-MIR5372, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR5774b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR5786, gma-MIR156t, gma-MIR2606a, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR4348b, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR4348c, gma-MIR319q, gma-MIR4348d, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR4414b, gma-MIR399n, gma-MIR399o
Recently, Xu et al. studied detailed response of miRNAs to low N availability in maize shoots and roots at the whole genome level and found that under long-term low N condition, miR167, miR169, miR395, miR399, miR408, and miR528 were down-regulated in maize roots, and in maize leaves miR164, miR172, and miR827 were up-regulated while miR169, miR397, miR398, miR399, miR408, and miR528 were down-regulated. [score:10]
In soybean shoots, some species of gma-miR397, gma-miR398 and gma-miR408-5p family were found to be down-regulated in response to long -term low N, and gma-miR398c-5p was found to be down-regulated in response to short -term low N. These results were consistent with the results obtained from research of Xu et al. [30], but gma-miR164, gma-miR172, gma-miR528 and gma-miR827 did not show significantly differential expression under long-term and short-term N limitation, which were different from the results obtained from research of Xu et al. [30]. [score:9]
We found that in soybean roots, gma-miR408 family were up-regulated in response to long-term low N, and some species of gma-miR160 and gma-miR319 family were down-regulated in response to short-term low N. However, members of gma-miR167 and gma-miR168 were not responsive, which were contrary to the results obtained from research of Xu et al. [30]. [score:7]
Nine miRNA families (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) and nine miRNA families (miR160, miR167, miR168, miR169, miR319, miR395, miR399, miR408, and miR528) were identified to respond to low N in maize shoots and roots respectively [30]. [score:1]
[1 to 20 of 4 sentences]
[+] score: 20
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR391, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR167j, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Also in a recent report, miR408 was found to be expressed in Selaginella and to target a conserved plantacyanin transcript [27]. [score:5]
miR408 has been shown to guide cleavage of plantacyanin, its target transcript in rice [3]. [score:3]
The deep conservation of miR408 across the plant kingdom indicates that the regulation of plantacyanin transcript levels has been preserved for a long time. [score:2]
As a result, Zhang et al. [21] classified miR408 as one of the lowly conserved miRNAs. [score:1]
Similarly, seven families (miR164, miR168, miR172, miR393, miR395, miR398 and miR408) were found in 20–29 diverse plant species. [score:1]
We also found five families (miR159, miR160, miR164, miR166 and miR168) conserved in gymnosperms and two (miR396 and miR408) in Selaginella. [score:1]
By searching the EST database alone, miR408 homologs were found in nine plant species. [score:1]
Thus, miR408 is one of the deeply conserved miRNAs. [score:1]
This includes one new member for each of the families, miR158, miR159, miR160, miR172, miR390, miR395 and miR408. [score:1]
We found six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) in 30–39 species; seven (miR164, miR168, miR172, miR393, miR395, miR398 and miR408) in 20–29 species; and five (miR162, miR390, miR397, miR403 and miR437) in 10–19 species (Table 1). [score:1]
miR408 was cloned from Arabidopsis and rice [3, 26]. [score:1]
In this study, we found miR408 homologs in 23 diverse plant species, including Selaginella (Table 1). [score:1]
Accordingly, miR395, miR399, miR403 and miR408 families were classified as lowly conserved [21]. [score:1]
[1 to 20 of 13 sentences]
[+] score: 16
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The targets of the Pi starvation -induced miR169o, miR397a, miR408c, miR4416a, miRnov_2, and miRnov_7 were detected in the degradome library or computationally predicted, as were the targets of the P limitation-repressed miRNAs miR159e-3p, miR169r, miR2109, miR4376, miRnov_5a, miRnov_5b, and miRnov_6a (Table 6). [score:5]
Table 3 demonstrates that miR408c was highly expressed in leaves in +Pi and induced even further in -Pi. [score:3]
Arabidopsis miR398a, miR398b, miR398c, and miR408 were repressed in leaves under Pi -depleted conditions [10], while Cu depletion induced the expression of miR408, miR399, and miR2111 in Arabidopsis, rice and Brassica [12]. [score:3]
Under drought conditions, miR408 is strongly induced in photosynthetic tissues in Medicago[58]. [score:1]
One last set of results in regards to P nutrition shows that miR778, miR398, miR169 and miR408 are also responsive to P limitation [10, 11]. [score:1]
This included most members of miR156, 164 and 167 families, along with 12 individual miRNAs (miR168, miR172b-3p, miR2118a, miR2118b, miR408c, miR1507a, miR1508d, miR1508e, miR1509a, miR1510b-5p, miR1510c, and miR1511) that were found in high abundance (>1000 TPM) in one or both of the HPL or LPL treatments (Tables 3, 4 and 5). [score:1]
In this study, miR408c was stimulated by low P in soybean leaves (Table 3, Figure 3), indicating divergent roles for this family among plant species, or complex interactions between P and Cu signaling in plants that remains to be adequately outlined. [score:1]
These results imply that miR408c might be an integrator of stresses. [score:1]
[1 to 20 of 8 sentences]
[+] score: 10
Read name Contig miRNA family MFE (kcal/mol) Target Ref E4UUDJH02I4UG8 contig25352 miR171 -37 SCARECROW-like protein Reinhart et al., 2002 E4UUDJH02HINHM contig16040 miR408 -29 plantacyanin Sunkar and Zhu, 2004 E4UUDJH01ECGTX contig11544 miR1171 -25 putative copper chaperone3 Molnar et al., 2007 E4UUDJH01AVSEX contig25342 miR414 -26 TIF3H1 Fattash et al., 2007 microRNA families and their target genes are also present in the table. [score:5]
A total of 4 miRNA candidates had sequence homology with miR171, miR408, miR1171 and miR414, which have been shown to target genes coding for SCARECROW-like proteins implicated in radial root pattern [57], plantacyanin [58], copper chaperone [59] and translation initiation factor [60], respectively (Table 3). [score:5]
[1 to 20 of 2 sentences]
[+] score: 8
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1510a, gma-MIR1511, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR4998, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5368, gma-MIR5371, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR4413b, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
In addition, the results of the present study revealed conserved miRNAs detected in other plants, such as miR166 (regulating shoot apical meristem and floral development in Arabidopsis) [63, 64], miR482 (in resistance to disease or abiotic stress via NBS-LRR proteins) [65], miR319 (affecting organ development and the processes of phase change in Arabidopsis) [46], miR160 (responses to the plant hormone auxin) [66], miR167 (involved in the floral organ formation) [27], miR390 (influence not only vegetative developmental transitions but also organ polarity in flowering plants) [67, 68], miR395 (regulating sulfate accumulation and allocation) [69], and miR408 (influenced through a variety of environmental conditions) [70, 71]. [score:8]
[1 to 20 of 1 sentences]
[+] score: 7
Other miRNAs from this paper: gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1512a, gma-MIR1518, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR5037c, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR171l, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR171m, gma-MIR171n, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR398d, gma-MIR9727, gma-MIR9750, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Expression of gma-miR399 and gma-miR408 were significantly induced by SCN in the susceptible cultivar KS4607 only. [score:3]
By comparison, miR408 was shown in wheat and Arabidopsis to target plantacyanin-like proteins, which play an important role in wheat resistance to stripe rust [48]. [score:3]
According to the functional analysis and previous reports, several conserved miRNAs (for example, gma-miR159, gma-miR171, gma-miR398, gma-miR399, and gma-miR408) and legume specific miRNAs (for example, gma-miR1512, gma-miR2119, and gma-miR9750) could be potential candidates for manipulating the SCN infection. [score:1]
[1 to 20 of 3 sentences]
[+] score: 5
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR162a, gma-MIR167c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1517, gma-MIR1520d, gma-MIR1520c, gma-MIR167d, gma-MIR1507b, gma-MIR1508b, gma-MIR167e, gma-MIR167f, gma-MIR172d, gma-MIR4341, gma-MIR4361, gma-MIR1520j, gma-MIR4369, gma-MIR4374b, gma-MIR482b, gma-MIR1520n, gma-MIR4387a, gma-MIR167g, gma-MIR4396, gma-MIR4397, gma-MIR1520r, gma-MIR4399, gma-MIR156f, gma-MIR4407, gma-MIR169d, gma-MIR156g, gma-MIR394a, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR398c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR156q, gma-MIR319n, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
It was reported that sulfate starvation lead to the up-regulation of miRNA395 [7] miR398 and miR408 were responded to water deficiency [10]. [score:4]
In this study, the majority of miRNAs occurring at low frequencies, with no more than 100 read tags, such as miR408 and miR1517, showed poor conservation. [score:1]
[1 to 20 of 2 sentences]
[+] score: 5
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1513a, gma-MIR1520d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1513b, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1513c, gma-MIR4415b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR319q, gma-MIR169w
Family Acronym miRNA Sequence Size (nt) Species MIR170 gma-MIR170 UAUUGGCCUGGUUCACUCAGA 21 ath, aly MIR395 gma-MIR395a CUGAAGUGUUUGGGGGAACUC 21 ath, ptc, vvi, sly, rco, aly, csi, osa, gma-MIR395b CUGAAGUGUUUGGGGGAACUC 21 sbi, mtr, zma, tae, pab gma-MIR395c CUGAAGUGUUUGGGGGAACUC 21 MIR397 gma-MIR397a UCAUUGAGUGCAGCGUUGAUG 21 ath, osa, ptc, bna, vvi, sbi, bdi, rco, gma-MIR397b UCAUUGAGUGCAGCGUUGAUG 21 aly, csi, zma, pab, sly, hvu MIR408 gma-MIR408a AUGCACUGCCUCUUCCCUGGC 21 ath, ptc, pta, vvi, ahy, aly, csi, osa, gma-MIR408b-5p CUGGGAACAGGCAGGGCACG 20 sof, zma, ppt, smo, gma-MIR408b-3p AUGCACUGCCUCUUCCCUGGC 21 tae, sbi, bdi, rco, aqc gma-MIR408c AUGCACUGCCUCUUCCCUGGC 21 MIR2118 gma-MIR2118a-5p GGAGAUGGGAGGGUCGGUAAAG 22 gma-MIR2118a-3p UUGCCGAUUCCACCCAUUCCUA 22 pvc, gso, mtr, osa, zma gma-MIR2118b-5p GGAGAUGGGAGGGUCGGUAA 20 gma-MIR2118b-3p UUGCCGAUUCCACCCAUUCCUA 22 MIR3522 gma-MIR3522a UGAGACCAAAUGAGCAGCUGA 21 gso Arabidopsis lyrata (aly), Arabidopsis thaliana (ath), Brassica napus (bna), Ricinus communis (rco), Medicago truncatula (mtr), Phaseolus vulgaris (pvu), Arachis hypogaea (ahy), Glycine soja (gso), Aquilegia coerulea (aqc), Seleginella moellendorffii (smo), Physcomitrella patens (ppt), Pinus taeda (pta), Picea abies (pab), Populus trichocarpa (ptc), Citrus sinensis (csi), Vitis vinifera (vvi), Solanum lycopersicum (sly), Brachypodium distachyon (bdi), Hordeum vulgare (hvu), Oryza sativa (osa), Saccharum officinarum (sof), Selaginella moellendorffii (smo), Sorghum bicolor (sbi), Triticum aestivum (tae), and Zea mays (zma). [score:1]
For families MIR170 and MIR3522, only a single locus was identified, and for MIR408, three genes were found. [score:1]
In two families, MIR408 and MIR2118, we detected sense and antisense miRNAs (Table 3). [score:1]
MIR408 was found in more different plants species than the other families. [score:1]
The families MIR170, MIR395, MIR397, MIR408, MIR2118 and MIR3522 were detected for the first time in soybean. [score:1]
[1 to 20 of 5 sentences]
[+] score: 4
Other miRNAs from this paper: mtr-MIR162, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR395a, mtr-MIR395b, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR319a, mtr-MIR156a, mtr-MIR171a, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, mtr-MIR395c, mtr-MIR395d, mtr-MIR395e, mtr-MIR395f, mtr-MIR395g, mtr-MIR395h, mtr-MIR395i, mtr-MIR395j, mtr-MIR395l, mtr-MIR395m, mtr-MIR395n, mtr-MIR395o, mtr-MIR395k, mtr-MIR156b, mtr-MIR164a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR390, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR319b, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR164b, mtr-MIR156h, mtr-MIR166f, mtr-MIR164c, mtr-MIR164d, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, gma-MIR162a, gma-MIR164a, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR1521a, mtr-MIR1507, mtr-MIR1509a, gma-MIR1507b, gma-MIR2109, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, mtr-MIR2118, mtr-MIR169k, mtr-MIR2111c, mtr-MIR2111d, mtr-MIR2111e, mtr-MIR2111g, mtr-MIR2111h, mtr-MIR2111i, mtr-MIR2111m, mtr-MIR2111n, mtr-MIR2111o, mtr-MIR169j, mtr-MIR1509b, mtr-MIR2111b, mtr-MIR2111j, mtr-MIR2111k, mtr-MIR399q, mtr-MIR2678, lja-MIR2111, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR4416a, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR530a, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR1521b, gma-MIR169i, mtr-MIR5204, mtr-MIR5213, mtr-MIR482, mtr-MIR2111l, mtr-MIR2111f, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, gma-MIR862b, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR1512b, gma-MIR171l, mtr-MIR168c, mtr-MIR408, mtr-MIR2111a, gma-MIR2111a, gma-MIR1512c, gma-MIR530b, mtr-MIR171g, mtr-MIR530, gma-MIR4416b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR530c, gma-MIR828b, gma-MIR530d, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR530e, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, lja-MIR171a, lja-MIR171b, lja-MIR171c, lja-MIR171d, lja-MIR172a, lja-MIR172b, lja-MIR172c, lja-MIR390a, lja-MIR390b, lja-MIR397, lja-MIR408, lja-MIR1507a, lja-MIR1507b, mtr-MIR169i, mtr-MIR172d, mtr-MIR319c, mtr-MIR319d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR319q, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o, lja-MIR164, lja-MIR398, lja-MIR168, lja-MIR395, lja-MIR1511, lja-MIR166
In addition, miR408 and miR857 were also regulated in response to Cu [2+] through SPL7; although their level does not increase during nodulation (De Luis et al., 2012). [score:2]
AGO1 and AGO2 act redundantly in miR408 -mediated Plantacyanin regulation. [score:2]
[1 to 20 of 2 sentences]
[+] score: 4
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4345, gma-MIR396d, gma-MIR4369, gma-MIR482b, gma-MIR167g, gma-MIR4397, gma-MIR156f, gma-MIR4409, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5373, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR1513c, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR1512c, gma-MIR5767, gma-MIR5770a, gma-MIR393b, gma-MIR5781, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR5770c, gma-MIR1446, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Recently, several studies reported differential expression of miRNAs such as miR164, miR169, miR171, miR396, miR398, miR399, miR408 and miR2118 in drought-stressed plants but their regulation (up or down) differed between different plant species [5]. [score:4]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR408, ath-MIR156g, ath-MIR156h, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, ath-MIR848, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1527, gma-MIR1533, gma-MIR396c, pvu-MIR166a, pvu-MIR399a, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, ath-MIR5021, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR171l, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR169w
Basic blue proteins (Plantacyanins) are validated targets for miR408 family in Arabidopsis and rice [70, 72]. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1523a, gma-MIR1528, gma-MIR1535a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR1509b, gma-MIR396d, gma-MIR4366, gma-MIR4382, gma-MIR4389, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR4411, gma-MIR171c, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, gma-MIR1507c, gma-MIR1508c, gma-MIR1535b, gma-MIR4996, gma-MIR1523b, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5374, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR396i, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5667, gma-MIR5761a, gma-MIR4416c, gma-MIR5761b, gma-MIR4416b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l, gma-MIR169w
Most of these known miRNAs, such as miR3522, miR1510, miR408, miR1509, miR4996, miR1508, miR1507 and miR167, were relatively highly expressed in both the control and chilling -treated libraries. [score:3]
[1 to 20 of 1 sentences]
[+] score: 2
1Unknown function            Gm17:35,366,63203g00550.1Retrovirus related Pol            Gm14:13,971,43913g22840.1polyprotein            Gm17:9,044,867 none19AGAATCTTGATGATGCTGCAT21gma-miR172a/b2321025830349616Gm20:40,895,75112g07800.1AP2-like transcription factor            Glyma13g39860.1*11g15650.1“            Gm12:6,110,72315g04930.1“            Gm10:31,592,58013g40470.1“            Gm10:43,474,79902g09600.1“20CAGGGGAACAGGCAGAGCATG21gma-miR408c/a-5p50110223124669Glyma10g27760.1*11g01200.1DNA-directed RNA            Gm02:837,430 polymerase21TTGGCATTCTGTCCACCTCC20gma-miR394c-5p286102711471324120Glyma17g38110.1*18g00870.1F-box protein            Gm15:3,767,18805g28050.1“            Glyma14g39920.1*08g11030.1“            Gm08:9,880,08411g36960.1“            Glyma06g02270.1*              Glyma05g30360.1*  22TAGAAAGGGAAATAGCAGTTG21gma-miR1508a/b46418752120913 78927041063Gm16:32,903,80109g30500.1Pentatricopeptide            Gm09:28,530,23716g27800.1repeat-containing protein             09g39260.1“             09g39250.1“23TAAGAGAATTGTAAGTCACTG21gma-miR441332293346721097391Glyma19g02070.109g07250.1Pentatricopeptide             07g11410.1repeat-containing protein             07g11290.1“             16g31950.1“             09g07300.1“                           09g30620.1 “ [a]Normalized read counts higher than 5000 are in bold. [score:2]
[1 to 20 of 1 sentences]
[+] score: 2
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1516a, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR4387c, gma-MIR1520h, gma-MIR1520i, gma-MIR396d, gma-MIR1520j, gma-MIR4365, gma-MIR4387b, gma-MIR482b, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR4387a, gma-MIR4387d, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR169d, gma-MIR1520q, gma-MIR171c, gma-MIR169e, gma-MIR4413a, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR862a, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR1516b, gma-MIR169h, gma-MIR167h, gma-MIR5039, gma-MIR169i, gma-MIR396f, gma-MIR5041, gma-MIR396g, gma-MIR167i, gma-MIR862b, gma-MIR5372, gma-MIR5374, gma-MIR5376, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR1512b, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5668, gma-MIR5671a, gma-MIR1512c, gma-MIR4387e, gma-MIR393b, gma-MIR1516c, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1516d, gma-MIR398d, gma-MIR5671b, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
There were 16 miRNA families which were co-regulated in both two genotypes, among them, miR156, miR162, miR166a, miR167, miR319, miR397, miR398, miR408 were conserved miRNAs between plants species, two miRNA families, miR2119 and miR3522 were conserved in fabaceae, while miR1520, miR4365, miR4387, miR4413, miR4996 and miR5671 were soybean specific miRNAs. [score:2]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
Noticeably, miR162, miR394 and miR408, which showed low copy number in the other plant species, were not detected in date palm in our analysis. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR164a, gma-MIR167c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR172c, gma-MIR482b, gma-MIR156f, gma-MIR171c, gma-MIR394b, gma-MIR156g, gma-MIR394a, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR168b, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR862b, gma-MIR5037c, gma-MIR171j, gma-MIR408a, gma-MIR408b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR482d, gma-MIR171l, gma-MIR5770a, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR319n, gma-MIR171p, gma-MIR394d, gma-MIR156r, gma-MIR171q, gma-MIR156s, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR171s, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR319o, gma-MIR319p, gma-MIR319q
These included miRNAs-3p members of four miRNA families, i. e., miR160 (miR160a), miR171 (miR171b and miR171i), miR394 (miR394a and miR394b) and miR408 (miR408a and miR408c) (S2 Table and Fig 4A). [score:1]
[1 to 20 of 1 sentences]