sort by

3 publications mentioning hsa-mir-4455

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-4455. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 7
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
[1 to 20 of 1 sentences]
2
[+] score: 3
Further, in the plasma of patients with COPD, miR-4455 and miR-4785 were differentially expressed between current smokers and never-smokers [81]. [score:3]
[1 to 20 of 1 sentences]
3
[+] score: 1
Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-2861 [47, 48], miR-4530 [49], miR-638 [50], miR-371b-5p [51], miR-1225-5p [52, 53], miR-296-5p [54, 55], miR-4787-5p [56], miR-4281 [57], miR-4455 [58], miR-197-3p [59], miR-369-5p [60, 61] and miR-505-3p [62] which were found to be altered in brucellosis in our analysis. [score:1]
[1 to 20 of 1 sentences]