sort by

2 publications mentioning gso-MIR1510a

Open access articles that are associated with the species Glycine soja and mention the gene name MIR1510a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 16
Subsequently, in a high-throughput sequencing study in M. truncatula, miR160, miR319, miR396, miR1507 miR1510a and miR390 were found to be down-regulated after treatment with Al, while miR166 and miR171 were not responsive to Al [50]. [score:4]
Furthermore, we found that miR1510a was not responsive to Al stress, while mir1510a-p5 was up-regulated under Al stress. [score:4]
Furthermore, cleavage fragment of the eight genes targeted by gso-miR1510 were found in the Al -treated library, but only two of them were identified in the Al-free library (Additional file 3). [score:3]
The p3/p5 strands of five unconserved miRNAs (gso-mir1509a-p3, gso-mir1510a-p5, gso-mir2109-p3, PN-miR4387e-p5 and PN-mir4415-p3) were differentially expressed between the two libraries. [score:3]
151.23PN-miR169cAAGCCAAGGATGACTTGCCGA174717.9644.481.31PN-miR390bAAGCTCAGGAGGGATAGCACC133613.7434.071.31PN-miR862a, bGCTGGATGTCTTTGAAGGAAT113355119.41335.951.49PC-39-5pTAGATTTTAAAGTTGCGGATCA103210.5730.281.52gso-mir1509a-p3ACCGTGTTTCCTTGGTTAACG9349.5132.181.76PC-25-3pCTACATAAGGCACGAGATCATC7297.4027.441.89gso-mir1510a-p5AGGGATAGGTAAAACAATGAC6256.3423.661.90PN-miR4387e-p5TCACGCCTAATCACTGACGCA114911.6246.372.00PN-miR1514aTTCATTTTTAAAATAGGCATTGGG115111.6248.262.05PN-mir4415-p3TTGATTCTCATCACAACATGG4124343.32229.962.41PC-33-3pGGAGAACAAAGAAGCAGCTAAATTC4294. [score:1]
We found that NB-ARC domain, LRR domain and TIR domain transcripts (encoding the three domain TIR-NBS-LRR protein) were cleaved by the gso-miR1510 family of miRNAs. [score:1]
[1 to 20 of 6 sentences]
2
[+] score: 6
Interestingly, miR1510 can target multiple PHAS loci, including three regions in C08 and four regions in W05 (Table S6b and Table S6c). [score:3]
Furthermore, four miRNAs (miR1507, miR1509, miR1510, and miR1514) in C08 and five miRNAs (miR1508, miR1510, miR1514, miR393, and miR5674) in W05 were predicted to trigger more than one PHAS locus. [score:1]
By contrast, miR1510a/b abundance was more than seven-fold higher in W05 than in C08 (Table S4a). [score:1]
Ten known miRNAs were differentially accumulated between C08 and W05 cotyledons (Figure 3, Table S4a) in which only miR1510a/b, miR1511, miR156r, and miR5670b had high counts. [score:1]
[1 to 20 of 4 sentences]