sort by

72 publications mentioning mmu-mir-486b

Open access articles that are associated with the species Mus musculus and mention the gene name mir-486b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 401
Other miRNAs from this paper: mmu-mir-206, hsa-mir-206, hsa-mir-486-1, mmu-mir-486a, hsa-mir-486-2
The miR-486-transgenic mice showed significantly decreased mRNA expression of the miR-486 downstream target genes (mRNA for Pdgfrβ and Foxo1) in their skeletal muscles at specific time points during days 3 through 7 post-CTX injury as would be expected if these genes were direct miR-486 targets (Figure 6). [score:8]
To identify what function miR-486 might play in normal human myoblasts, we infected cells with a lentivirus that would either overexpress miR-486 precursor miRNA, express a miR-486 inhibitor (anti-miR-486) or a scrambled miRNA -negative control virus (Figure 2). [score:7]
uk/enright-srv/microcosm/htdocs/targets/v5/) to identify those genes whose expression might be altered by miR-486 expression. [score:7]
At the same critical time point during skeletal muscle injury (days 3 through 5) in the miR-486-Tg mice, there was a reduction in the levels of the Foxo1 targets p21 and p27, but not p57 (Figure 6 and Additional file 5, Figure S5), which is not a direct target of Foxo1 signaling [32] but has been shown to play an essential role in skeletal muscle formation [33]. [score:6]
However, given that miR-486 expression is activated by myogenic factors that are downstream of Pax7 (such as MyoD1), it is likely that miR-486's regulation of PTEN/AKT signaling might explain the cell cycle defects due to the Pax7 [+ ]low expression in MyoD1 [+ ]myoblasts [45, 46]. [score:6]
Normal biopsies: n = 5, DMD biopsies: n = 5 and BMD biopsies: n = 3. (C) miR-486 is significantly upregulated during normal human myogenic differentiation, while the DMD myoblasts express miR-486 at significantly lower levels. [score:6]
Additionally, our identification of miR-486 as a potent repressor of several components of the PTEN/AKT signaling pathway follows, as many of these signaling components are shown to be upregulated in DMD muscle while miR-486 is expressed at reduced levels. [score:6]
miR-486 expression in myoblasts most likely is expressed at a threshold level necessary for myoblast cellular viability, which is compromised in the absence of a functional dystrophin protein. [score:5]
Overexpression of miR-486 in myoblasts also decreased the levels of the FOXO1 targets p21 and p27 (Figure 4C). [score:5]
Inhibition of miR-486 in normal muscle myoblasts results in inhibited migration and failure to repair a wound in primary myoblast cell cultures. [score:5]
Figure 2 Overexpression and inhibition of miR-486 causes profound cellular changes in myoblasts and myotubes. [score:5]
In a recent study, miR-486 was identified as a negative regulator of PTEN expression levels in muscle and subsequently in the PTEN/AKT pathway in normal cardiac and skeletal muscle development [20]. [score:5]
Normal and DMD myoblasts were infected at 50% confluency with lentivirus expressing miR-486, miR-486 inhibitor (anti-miR) or a scrambled miRNA control virus and allowed to differentiate to 90% confluency. [score:5]
By day 2 postdifferentiation, the normal human myoblasts expressing miR-486 had amounts of multinucleated myotubes similar to those of the control scrambled miRNA myoblasts, whereas the anti-miR-486 -expressing myoblasts had significantly reduced amounts of multinucleated myotubes (Figures 3A and 3B). [score:5]
That study also demonstrated that miR-486 expression can be activated by myocardin-related transcription factor A (MRTF-A, also referred to as MAL/MKL1) [20], a coregulator of the serum response transcription factor, which has been shown to regulate actin polymerization and Rho signaling in cardiac hypertrophy [40, 41]. [score:5]
Given that two of the components that are essential for normal alternative splicing of mRNA (splicing factor, arginine/serine-rich 1 (SFRS1) and SFRS3) are likely targets of miR-486, it is possible that miR-486 could play a role in the translation of genes essential for normal cellular homeostasis in other tissues, such as the brain. [score:5]
To identify what effect manipulating miR-486 expression levels in myoblasts and myotubes might have on cellular kinetics, fusion and viability, miR-486 expression was manipulated in both normal and DMD myoblast cell lines. [score:5]
miR-486's influence on cell cycle progression through the regulation of PTEN/AKT signaling components and their subsequent downstream regulation of cyclin -dependent kinase inhibitors reinforces the role of miR-486 as a biomarker in several cancers. [score:5]
In DMD myoblasts, overexpression of miR-486 again had little effect on cellular viability, whereas inhibition of miR-486 resulted in increased caspase-3/7 levels and thus increased cellular apoptosis (Figure 3C) (P < 0.05 for normal myoblasts and P < 0.005 for DMD myoblasts). [score:5]
Additionally, myoblasts expressing the anti-miR-486 inhibitor had reduced amounts of MF20 [+ ]cells (myosin heavy chain) as they began to elongate and fuse to form myotubes (Figure 2D). [score:5]
Another recent study identified miR-486 along with miR-206 (another muscle-enriched miRNA) as a regulator of myoblast cell cycle kinetics through its downregulation of Pax7 mRNA and another muscle-enriched miRNA, miR-206 [44]. [score:5]
Myoblasts expressing high miR-486 or scrambled miRNA showed no differences in the percentage of Ki-67 [+ ]cells; however, both normal and DMD anti-miR-486 -expressing myoblasts showed reduced amounts of Ki-67 [+ ]cells (Figure 3D). [score:5]
Note that the myoblasts overexpressing the miR-486 inhibitor (anti-miR-486) appear rounded and have not flattened out (inset). [score:5]
Thus, one might hypothesize that the presence of the large Dp427 skeletal muscle isoform is essential for maintaining normal miR-486 expression levels, especially since BMD patients with a partially functional truncated dystrophin protein [3] have normal miR-486 regulation in muscle, which we have validated in this study. [score:4]
One particular miRNA, miR-486, was significantly and specifically downregulated in DMD muscle, but not in patients with BMD. [score:4]
Most myoblasts in which miR-486 was inhibited showed little elongation and had increased cellular size compared to those overexpressing miR-486 and control infected myoblasts as quantified by fluorescence-activated cell sorting (FACS) analysis (Figure 2E). [score:4]
In summary, these studies identify miR-486 as a uniquely downregulated miRNA in DMD. [score:4]
Recently, miR-486 has been found to be significantly upregulated in lymphoblast cell lines derived from autistic patients [47]. [score:4]
One particularly muscle-enriched miRNA, miR-486, is significantly downregulated in dystrophin -deficient mouse and human skeletal muscles. [score:4]
Generation of muscle-specific miR-486-transgenic mice revealed perturbed muscle regeneration following cardiotoxin (CTX) -induced tibialis anterior (TA) muscle injury and dysregulation of the downstream target genes of miR-486 in vivo. [score:4]
Figure 4 Members of the PTEN/AKT signaling pathway and splicing factors are direct downstream targets of miR-486 in skeletal muscle. [score:4]
miR-486 overexpression in mouse skeletal muscle results in dysregulation of PTEN/AKT downstream signaling components. [score:4]
In contrast, DMD myoblasts exhibit a slight increase in the expression levels of miR-486 during myogenic differentiation, but at significantly reduced levels compared to normal myoblasts, before miR-486's expression decreases by day 4 of myogenic differentiation (Figure 1C). [score:4]
The lower graph shows results from the mutation of the miR-486 seed site, which ablates miR-486 binding and functions to derepress luciferase expression. [score:4]
miR-486 may also have important regulatory functions that are independent of PTEN/AKT signaling in other cell types and pathological diseases. [score:4]
With many targets of miR-486 residing in the PTEN/AKT signaling pathway (both upstream and downstream), it is likely that miR-486 functions as a regulator of cell cycle kinetics, cell cycle viability and perhaps cellular migration in skeletal muscle (Figure 7). [score:4]
Note the decreased levels of Ki-67 in myoblasts in which miR-486 expression is knocked down. [score:4]
Thus, miR-486 appears to be an important miRNA that is dynamically regulated during normal skeletal muscle regeneration, and its expression is significantly reduced in mdx [5cv ]mice. [score:4]
Myoblasts expressing either scrambled miRNA or high levels of miR-486 showed no visible physiological or significant structural differences at both the myoblast and myotube stages of differentiation (Figures 2A and 2B). [score:3]
miRNA-486 expression is a significantly reduced miRNA in dystrophin -deficient skeletal muscle. [score:3]
Lentivirus vectors that stably overexpress a pre-miR-486 precursor, anti-miR-486 (miRZipsSystem Biosciences Inc. [score:3]
miRNA repression of genes can occur by either mRNA degradation or inhibition of mRNA translation, and it is necessary to measure the protein levels of genes containing the miR-486 seed sites. [score:3]
The following day the cells were transfected using Lipofectamine 2000 reagent with 30 ng of 3'UTR miRNA-luc reporter constructs and 100 ng of miR-486 overexpression plasmid (Origene, Rockville, MD, USA); pCMVmiR-IRES-GFP vector) or scrambled miRNA controls (Origene). [score:3]
Myoblasts overexpressing lentiviral anti-miR-486-GFP fail to migrate to close the wound 12 hours post-scratch infliction. [score:3]
Another recent study profiling dysregulated miRNA in mdx mouse muscle demonstrated that the lack of dystrophin resulted in the dysregulation of several miRNA, including miR-486, which further validates our findings that miR-486 is reduced in the absence of a functional dystrophin. [score:3]
Using bioinformatics and, we have identified platelet-derived growth factor receptor β, along with several other downstream targets of the phosphatase and tensin homolog deleted on chromosome 10/AKT (PTEN/AKT) pathway, as being modulated by miR-486. [score:3]
Figure 1 miR-486 is a highly conserved mammalian miRNA that is differentially expressed in DMD skeletal muscle. [score:3]
Evolutionary conservation between human and mouse seed regions of predicted miR-486 downstream target genes. [score:3]
Given that miRNA are known to regulate several components in the same pathway, it seems likely that miR-486 acts on the p21/FOXO1 pathway through its primary regulation of the PTEN/AKT pathway. [score:3]
Inhibition of miR-486 using a GFP-tagged lentivirus impaired cellular migration to a scratch wound injury, decreased myoblast fusion and increased cellular mitosis. [score:3]
Together these results implicate a delay in skeletal muscle regenerative capacity in mice that maintain increased miR-486 levels and further implicate miR-486 as a potential indirect regulator of muscle satellite cell kinetics and fusion capabilities during muscle regeneration. [score:3]
Following prediction of the transcripts which were thought to be targets of miR-486, the 3'UTR regions of these genes were amplified by PCR from a human total mRNA library (Ambion) or from commercially cloned constructs (GeneCopoeia Inc. [score:3]
When challenged with a scratch wound assay, myoblasts infected with lentivirus that caused overexpression of miR-486 migrated at a faster rate and closed the wound almost completely after 12 hours compared to control myoblasts expressing scrambled miRNA (Additional file 2, Figure S2). [score:3]
To validate the miRNA microarray results indicating that miR-486 expression was significantly reduced in DMD muscles relative to control muscles, total miRNA was extracted from patients diagnosed with DMD or BMD or from normal controls (Figure 1B). [score:3]
To develop these mice, a DNA construct containing the mouse miR-486 genomic sequence was cloned downstream of the muscle CK (MCK) enhancer element, which is expressed exclusively in the heart and skeletal muscle myofibers, thus excluding muscle satellite cells [29]. [score:3]
Transgenic mice overexpressing miR-486 have altered levels of PTEN/AKT signaling components during skeletal muscle regeneration. [score:3]
Real-time qPCR of miR-486 expression levels in the TA muscle was analyzed from three separate wild-type (black bars) and miR-486 Tg (red bars) adult mice. [score:3]
However, in normal human myoblasts in which miR-486 was inhibited, the myoblasts showed increased size and failed to flatten out as they divided and expanded across the plate. [score:3]
Overexpression of miR-486 resulted in significant decreases in the luciferase activity in the PDGFRβ-luc, PTEN-luc, PIK3R1-luc, SFSR1-luc and SFSR3-luc reporter plasmids (Figure 4B). [score:3]
Transgenic mice expressing miR-486 have impaired skeletal muscle regeneration following CTX injury. [score:3]
Inhibition of miR-486 in myoblasts and myotubes causes profound physical and cellular changes. [score:3]
In cardiomyocytes, miR-486 has been shown to be a negative regulator of PTEN/AKT signaling during heart ventricle postnatal development [20]. [score:3]
Using computational bioinformatics, we identified additional miR-486 downstream targets in adult skeletal muscle: PDGFRβ, PIK3R1 (p85α) and insulin-like growth factor 1 (IGF-1). [score:3]
Chart indicates reduced levels of MF20 [+ ]myoblasts that express anti-miR-486 lentivirus; conversely, myoblasts with high levels of miR-486 have increased amounts of MF20 [+ ]myoblasts. [score:3]
These studies demonstrate a link for miR-486 as a regulator of the PTEN/AKT pathway in dystrophin -deficient muscle and an important factor in the regulation of DMD muscle pathology. [score:3]
Conversely, mdx [5cv ]mice, which have impaired skeletal muscle regeneration following CTX injury [24], showed overall reduced levels of miR-486 during skeletal muscle regeneration, which were statistically significant (P < 0.005) at day 5 after CTX injury, when there is maximum miR-486 expression in normal mouse muscle (Figure 1D). [score:3]
In human myoblasts obtained from normal and DMD biopsies, miR-486 was expressed at similarly low levels early in myogenic differentiation (Figure 1C). [score:3]
Among the list of potential genes possibly modulated by miR-486 expression, only those that were evolutionarily conserved across human and mouse genomes were selected. [score:3]
Overexpression of miR-486 resulted in significantly decreased protein levels of PTEN, PDGFRβ, FOXO1, SFSR1 and SFSR3 (Figure 4C). [score:3]
In addition, all miR-486 targets were verified at the protein level by. [score:3]
Several components of the PTEN/AKT signaling pathway are predicted targets of miR-486 in mammals (human and mouse). [score:3]
Real-time qPCR of PTEN/AKT signaling targets (p57, Bcl2, Bim and Bax) in adult wild-type and miR-486 Tg mice during a CTX -induced skeletal muscle injury time course (days 0 to 14). [score:3]
Figure 5 Transgenic miR-486 overexpression in mice results in abnormal skeletal muscle regeneration following CTX -induced TA injury. [score:3]
However, inhibition of miR-486 in normal myoblasts increased levels of caspase-3/7 and resulted in higher levels of apoptosis. [score:3]
Modulation of the PTEN/AKT signaling pathway through miR-486 expression has the potential to be a novel therapy for treating DMD. [score:3]
The MCK-miR-486-Tg overexpression mouse lines were generated using the pBS-MCK backbone plasmid obtained from Addgene (plasmid 12528; Addgene, Cambridge, MA, USA). [score:3]
By day 4 postinfection, the myotubes infected with the miR-486 inhibitor virus began to break down and form large cellular aggregates (inset in Figure 2B). [score:3]
Real-time quantitative PCR (qPCR) revealed that miR-486 expression was significantly reduced in the muscle biopsies from DMD patients, but not in those from BMD patients with a fully or partially functioning dystrophin protein (n = 5 control biopsies, n = 5 DMD biopsies and n = 3 BMD biopsies). [score:3]
Conversely, overexpression of miR-486 in primary myoblast cell cultures results in increased proliferation with no changes in cellular apoptosis. [score:3]
These results imply that inhibition of miR-486 has detrimental effects on the ability of myoblasts to proliferate and maintain normal cellular kinetics. [score:3]
These 3'UTR-luc constructs were transfected into human embryonic kidney HEK293T cells along with constructs that overexpress miR-486, scrambled miRNA (negative control) plasmids or the vector alone. [score:3]
In normal mouse muscle, miR-486 expression was significantly increased by day 5 after CTX injury, which is when nascent myotubes begin to appear [22, 23] (Figure 1D). [score:3]
Mice that overexpress miR-486 in their muscles have increased amounts of Ki-67 [+ ]cells during skeletal muscle regeneration. [score:3]
These results suggest that miR-486 plays a role in the migration of myoblast progenitor cells and that alteration of miR-486 expression affects the signaling pathways essential for cellular migration. [score:3]
One can envision that a combination therapy involving the overexpression of intramuscular injection of stabilized miR-486 along with exon-skipping morpholinos might restore muscle function and prevent some of the muscle loss observed in DMD patients. [score:3]
To further examine the functional role of miR-486 in normal and dystrophic muscles, we utilized several bioinformatics software programs (TargetScan, http://www. [score:3]
Several genes that were possible targets for miR-486 were identified, including PTEN, PDGFRβ, FOXO1, IGF-1, PIK3R1 (p85α), SFSR1 and SFSR3 (Additional file 3, Figure S3). [score:3]
miR-486 expression is essential for normal myoblast migration and wound closure. [score:3]
The generation of muscle-specific transgenic mice that overexpress miR-486 revealed that miR-486 alters the cell cycle kinetics of regenerated myofibers in vivo, as these mice had impaired muscle regeneration. [score:3]
Normal human myoblasts showed increased proliferation and a higher fusion index while expressing higher levels of miR-486 at earlier time points compared with scrambled miRNA controls. [score:2]
Muscle biopsies from the injured wild-type and mdx [5cv ]mice were harvested, and total miRNA was extracted to determine whether the levels of miR-486 were dynamically regulated during skeletal muscle regeneration. [score:2]
Figure 7 miR-486 is an important regulator of PTEN/AKT signaling in normal and dystrophic muscle. [score:2]
miR-486 has also been shown to be dysregulated in three other pathological conditions: white blood cells during sepsis, glioblastomas and lung adenocarcinomas [35- 37]. [score:2]
Conversely, myoblasts infected with a lentivirus anti-miR-486 inhibitor failed to migrate following the scratch wound compared to scrambled miRNA controls (Additional file 2, Figure S2). [score:2]
Note that the anti-miR-486-infected myoblasts are rounded (arrowheads) and increased in overall size compared to the scrambled miRNA and miR-486 -overexpressing myoblasts. [score:2]
To test whether increased expression of miR-486 would influence in vivo regeneration of muscle, similar to our observations in cell culture, the miR-486-Tg mice were injected with CTX and their regenerative capacity was compared to the injured muscles of their wild-type littermates. [score:2]
Normal myoblasts expressing high levels miR-486 showed no significant differences compared to scrambled miRNA controls (Figure 3C). [score:2]
Together these studies begin to characterize a functional role for miR-486 in normal and dystrophin -deficient skeletal muscle and further identify several components of the PTEN/AKT signaling pathway as potential targets for miR-486 regulation in muscle. [score:2]
miR-486 regulates a variety of PTEN/AKT signaling components in skeletal muscle. [score:2]
Normal human myoblasts overexpressing lentiviral miR-486-GFP migrate faster to close the scratch wound compared with scrambled miRNA-GFP (negative control) 12 hours post-scratch wound. [score:2]
Together these studies implicate miR-486 as a negative regulator of the PTEN/AKT signaling components and their downstream effector proteins in vivo during skeletal muscle regeneration. [score:2]
Conversely, overexpression of miR-486 resulted in faster closure of the scratch wound, with no detrimental cellular apoptosis, compared to a scrambled miRNA control. [score:2]
Schematic of miR-486 regulation of PTEN/AKT pathway upstream and downstream signaling components in skeletal muscle is shown. [score:2]
FSC-H is quantified in the table that shows that anti-miR-486 (blue line) have increased in cell size compared to myoblasts overexpressing miR-486 (green line) and scrambled miRNA controls (red line). [score:2]
To measure the protein levels, normal human myoblasts were infected with lentiviruses expressing miR-486 along with an IRES-GFP reporter to indicate infection efficiency. [score:1]
Shown are nine highly evolutionarily conserved miR-486 seed sites located within seven different genes: PDGFRβ, FOXO1, PTEN, IGF-1, PIK3R1 (p85α), SFRS1 and SFRS3. [score:1]
The MCK miR-486-transgenic (miR-486-Tg) mice were viable and displayed no overt phenotypic differences from their wild-type littermate controls at six months of age, other than a slight increase in weight that was maintained for the remainder of their lifespan (Figure 5B). [score:1]
Conversely, myoblasts that had increased levels of miR-486 had significantly more MF20 [+ ]cells than the scrambled miRNA control infected myoblasts (Figure 2D). [score:1]
miR-486 is highly conserved among mammals and is embedded in the ANK1 gene locus within the intron between exons 41 and 42 (Figure 1A). [score:1]
The 3'UTR for each of the predicted transcripts that contained these miR-486 binding sites were cloned into a luciferase (luc) miRNA reporter (Figure 4A). [score:1]
One particular miRNA, miR-486, was significantly reduced in patients with DMD relative to control muscle biopsies. [score:1]
By 24 hours, all but the anti-miR-486-infected cells had fully migrated to close the scratch wound (data not shown). [score:1]
To determine the role that miR-486 might play in cellular viability, caspase-3/7 levels were measured in myoblasts that either overexpressed or knockdown miR-486 levels using a luminescent reporter assay. [score:1]
The graph denotes increased levels of Ki-67 [+ ]myogenic cells in the miR-486 Tg mice at days 7 and 14 post-CTX -induced TA injury. [score:1]
Delivery of miR-486 in skeletal muscle might have a beneficial effect in ameliorating the secondary signaling defects that are observed in dystrophin -deficient muscle. [score:1]
Pten levels remained reduced in the uninjured (day 0) miR-486-Tg muscles and at day 3 of muscle regeneration (Figure 6). [score:1]
miR-486 Tg (green bars). [score:1]
However, as normal skeletal myoblasts progress along myogenic differentiation to form mature myotubes, miR-486 significantly increases until it reaches a plateau at day 3 of differentiation. [score:1]
miR-486 Tg values. [score:1]
miR-486 Tg. [score:1]
miR-486 is essential for normal myoblast fusion, cellular kinetics and viability. [score:1]
miR-486 is embedded within the ANKYRIN1(ANK1) gene locus, which is transcribed as either a long (erythroid-enriched) or a short (heart muscle- and skeletal muscle-enriched) isoform, depending on the cell and tissue types. [score:1]
Note the aggregate of clumped myotubes (inset) in cells infected with the anti-miR-486 lentivirus. [score:1]
Further validation of these seed sites as binding sites for miR-486 was done by mutating several conserved bases of the eight-nucleotide seed site in the 3'UTR-luc reporters, which resulted in restoration of luciferase levels to those of scrambled miRNA and untransfected controls (Figure 4B). [score:1]
The y-axis represents mature miR-486 fold levels normalized to U6 snRNA loading controls, and the x-axis represents the time of myogenic differentiation from 50% confluency (proliferating myoblasts) until day 4 differentiation (multinucleated myotube formation). [score:1]
Therefore, in cell cultures, it appears that a reduction in miR-486 levels results in myotube destruction analogously to what may happen in the skeletal muscles of DMD patients. [score:1]
By day 14 post-CTX injury, the miR-486-Tg mice had recovered their muscle fiber architecture, but many centralized, multinucleated myofibers remained, whereas significantly fewer centralized myonuclei were observed in the day 14 wild-type controls (Figure 5D). [score:1]
Immunofluorescent staining of skeletal muscle from wild-type (WT) and miR-486 Tg mice at day 0 (uninjured), day 7 and day 14 post-CTX -induced TA injury. [score:1]
miR-486 alignment is 3' to 5', and the miR-486 binding site is 5' to 3'. [score:1]
The 6-kb MCK fragment plus the miR-486 sequence and a simian virus 40 (SV40) polyadenylation (poly(A)) signal were excised from the plasmid using KpnI/ SacI restriction enzymes. [score:1]
A 500-bp fragment containing the stem loop precursor sequence of mouse miR-486 was amplified by PCR from C57BL6/J mouse genomic DNA and subcloned into the PstI/ SpeI restriction sites of the pBS-MCK plasmid. [score:1]
Four-month-old male C57BL6/J and miR-486-Tg littermate mice were subjected to injections into their TA muscles with 10 μM CTX (C9759; Sigma-Aldrich) that was resuspended in 1× PBS. [score:1]
Note the decreased levels of fusion in both the normal and DMD myoblasts at two time points (day 2 (Figure 2A) and day 4 (Figure 2B) of differentiation) when infected with anti-miR-486. [score:1]
Intriguingly, no miR-486 miRNA sequence has been identified within the genomes of nonmammalian species, such as fish or avians, although these species have the Ank1 gene sequence. [score:1]
Figure 3 miR-486 is essential for normal myoblast fusion, cell cycle kinetics and viability in human skeletal myoblasts. [score:1]
The y-axis represents mature miR-486 fold levels normalized to U6 snRNA housekeeping controls. [score:1]
[1 to 20 of 136 sentences]
2
[+] score: 318
Other miRNAs from this paper: hsa-mir-486-1, mmu-mir-486a, hsa-mir-486-2
We showed that inhibition of miR-486-5p upregulated expression of the PTEN protein in HeLa cells, while overexpression of miR-486-5p downregulated PTEN protein expression in SiHa cells. [score:15]
We also confirmed that miR-486-5p directly targeted the 3′-untranslated region of the tumor-suppressor gene PTEN, inhibiting its expression, and that overexpression of miR-486-5p activated the PI3K/Akt pathway. [score:14]
e- f HeLa cells transfected with miR-486-5p inhibitor sponge (Inhibitor) or control miRNA (Mock) were placed in the transwell chambers and allowed to incubate for 24 h. g- h SiHa cells transfected with miR-486-5p mimic (Mimic) or control miRNA (Mock) were placed in the transwell chambers and allowed to incubate for 24 h. ** P < 0.01, compared with Mock MiR-486-5p activates the PI3K-Akt pathway by directly inhibiting PTENTo understand the mechanisms underlying the effects of miR-486-5p on cervical cancer, we examined the potential target of miR-486-5p by in silico analysis using the TargetScanHuman6.2 database (http://www. [score:11]
Suppression of miR-486-5p expression significantly inhibited HeLa cell proliferation, colony formation, migration, and invasion, as well as tumor growth in nude mice, while miR-486-5p overexpression stimulated SiHa cell proliferation, colony formation, migration, and invasion. [score:9]
Suppression of miR-486-5p expression significantly inhibited proliferation, colony formation, migration, and invasion of one cervical cancer cell line (HeLa) in vitro and inhibited tumor growth in a mouse HeLa xenograft mo del. [score:9]
Fig. 7Downregulation of miR-486-5p inhibits cervical cancer growth in vivo by targeting PTEN. [score:8]
e- f HeLa cells transfected with miR-486-5p inhibitor sponge (Inhibitor) or control miRNA (Mock) were placed in the transwell chambers and allowed to incubate for 24 h. g- h SiHa cells transfected with miR-486-5p mimic (Mimic) or control miRNA (Mock) were placed in the transwell chambers and allowed to incubate for 24 h. ** P < 0.01, compared with Mock To understand the mechanisms underlying the effects of miR-486-5p on cervical cancer, we examined the potential target of miR-486-5p by in silico analysis using the TargetScanHuman6.2 database (http://www. [score:8]
b miR-486-5p expression in HeLa cells transfected with miR-486-5p inhibitor sponge (Inhibitor) or matching control plasmid (Mock). [score:7]
In HeLa cells transfected with miR-486-5p inhibitor, expression of PTEN was significantly increased and expression of p-Akt was significantly decreased compared with that in Mock -transfected control cells (all, P < 0.05; Fig.   6a-b). [score:6]
Wang et al. found that miR-486-5p expression was decreased in non-small cell lung cancer (NSCLC) tumor tissue and that downregulation of miR-486-5p promoted tumor progression and migration [14]. [score:6]
Human cervical cancer cell lines HeLa and SiHa were selected to explore the effects of miR-486-5p downregulated or overexpression on cell proliferation, migration, and invasion, respectively. [score:6]
Our results show that expression of miR-486-5p in both serum and tumor tissue is increased in cervical cancer patients and that miR-486-5p expression level regulates cell proliferation, migration, and invasion of cervical cancer cells in vitro and tumor growth in vivo. [score:6]
Downregulation of miR-486-5p inhibits tumor growth in a cervical cancer xenograft mouse mo del. [score:6]
MiRNA-486-5p is a candidate regulator of phosphatase and tensin homolog (PTEN) in silico, and the downregulation of PTEN in cervical cancer is not consistent with its mutation, which suggests that PTEN may be subjected to post-transcription modification moderated by miRNAs. [score:6]
Transfection of plasmids expressing miR-486-5p inhibitor sponge into HeLa cells decreased miR-486-5p expression by 51% compared with cells transfected with the relevant control (Mock) plasmids (P < 0.01; Fig.   2b). [score:6]
In addition, IHC analysis showed that PTEN expression was markedly higher in the tumors formed from miR-486-5p inhibitor–transfected cells than in the tumors formed from control cells (Fig.   7d). [score:5]
The cells were co -transfected with a plasmid expressing miR-486-5p mimic or control miRNA and a vector expressing PTEN 3′-UTR or empty vector. [score:5]
This suggested that PTEN expression was suppressed by miR-486-5p binding to its 3′-UTR. [score:5]
Here, we aimed to explore whether miR-486-5p is a regulator in the development of cervical cancer through the PI3K/Akt pathway by targeting PTEN. [score:5]
The tumorigenic activity of miR-486-5p is mediated through inhibition of PTEN expression and activation of the oncogenic PI3K/Akt pathway. [score:5]
We conclude that miR-486-5p stimulates cell proliferation, migration, and invasion through inhibition of PTEN expression and activation of the oncogenic PI3K/Akt pathway in cervical cancer. [score:5]
a- b HeLa cells were transfected with miR-486-5p inhibitor sponge (Inhibitor) or control miRNA (Mock). [score:5]
Cervical cancer cells (2 × 10 [5] cells) were transfected with 1 μg of a plasmid expressing miR-486-5p inhibitor sponge, miR-486-5p mimic, or control miRNA (Genepharma, Shanghai, China). [score:5]
The cervical cancer mouse mo del was constructed by injecting mice with HeLa cells transfected with control miRNA (Mock) or miR-486-5p inhibitor sponge (Inhibitor). [score:5]
Its biological functions are mediated through PTEN, which was confirmed as a candidate target of miR-486-5p by the TargetScan database. [score:5]
We hypothesized that miR-486-5p is a crucial regulator in the development of cervical cancer through the PI3K/Akt pathway by targeting PTEN. [score:5]
a Cell proliferation assay comparing HeLa cells transfected with miR-486-5p inhibitor sponge (red) or control miRNA (black) for 96 h. b Cell proliferation assay comparing SiHa cells transfected with miR-486-5p mimic (blue) or control miRNA (black) for 96 h. c- d Colony formation assay: HeLa cells transfected with miR-486-5p inhibitor sponge (Inhibitor) or control miRNA (Mock) were incubated in 6-well culture plates. [score:4]
In our in vivo studies, knockdown of miR-486-5p increased PTEN expression in tumor tissue. [score:4]
a- b HeLa cells transfected with miR-486-5p inhibitor sponge (Inhibitor) or control miRNA (Mock) were scratched and incubated in medium with 2% FBS for 72 h. c- d SiHa cells transfected with miR-486-5p mimic (Mimic) or control miRNA (Mock) were scratched and incubated in medium with 2% FBS for 72 h. e- h Cell invasiveness was assessed by the transwell assay. [score:4]
In contrast, in SiHa cells transfected with miR-486-5p mimic, expression of PTEN was significantly decreased and expression of p-Akt was highly increased compared with that in the control cells (all, P < 0.05; Fig.   6c-d). [score:4]
In contrast, Li et al. demonstrated that miR-486-5p was increased in NSCLC patients’ serum and tumor tissue and that downregulation of miR-486-5p prolonged recurrence-free survival [16]. [score:4]
To demonstrate miR-486-5p directly bund to this gene, we co -transfected miR-486-5p mimic, control miRNA, or control plasmid with a vector expressing PTEN luc-3′-UTR or empty vector into 293 T cells, then caculated their luciferase activity. [score:4]
Moreover, we observed the effect of miR-486-5p downregulated on tumorigenesis using HeLa cell in vivo. [score:4]
As expected, the tumors that developed from the miR-486-5p–downregulated cells had significantly lower volumes and weights than those that formed from controls 4 weeks after inoculation (Fig.   7a-c). [score:4]
In contrast, upregulation of miR-486-5p via miR-486-5p mimic transfection enhanced proliferation of SiHa cells by 2.28-, 2.30-, 2.31-, and 2.31-fold, respectively, at 24 (P < 0.01), 48 (P < 0.001), 72 (P < 0.001), and 96 h (P < 0.001; Fig.   3b). [score:4]
This was further confirmed by a dual luciferase reporter assay whose results show that miR-486-5p directly targeted the PTEN 3′-UTR. [score:3]
c The correlation of miR-486-5p expression in cervical cancer patients’ serum and tissues. [score:3]
The wound closure rates of miR-486-5p inhibitor–transfected HeLa cells were 11.91%, 21.48%, and 31.04% lower 24 h, 48 h, and 72 h after scratching, respectively, than those of cells transfected with Mock control plasmid (P < 0.01, P < 0.01, and P < 0.01, respectively; Fig.   4a-b). [score:3]
There was a significant correlation between miR-486-5p expression in serum and in tissues (r = 0.50, P < 0.05, Fig.   1c). [score:3]
The correlation of miR-486-5p expression in cervical cancer patients’ serum and tissues, and the receiver operating characteristic (ROC) analysis of serum miR-486-5p expression in cervical cancer patients vs healthy subjects were analyzed by Graphpad 6.0 software. [score:3]
The expression level of miR-486-5p was assessed by using the relative quantification method with U6 as the reference gene and was verified by comparison with control cells. [score:3]
This analysis identified PTEN as a candidate target of miR-486-5p, with two binding sites (Fig.   5a). [score:3]
c miR-486-5p expression in SiHa cells transfected with miR-486-5p mimic (Mimic) or matching control plasmid (Mock). [score:3]
For each mouse, HeLa cells transfected with miR-486-5p inhibitor or control miRNA (10 [7] cells per mouse in 200 μL of serum-free medium) were injected subcutaneously into the left axilla of each mouse. [score:3]
The high expression of miR-486-5p in cervical cancer was verified by comparing with the controls. [score:3]
a Sequence alignment of miR-486-5p and its conserved target site in the PTEN 3′-UTR. [score:3]
a miR-486-5p expression in serum from healthy donors (Controls) and cervical cancer patients (Patients). [score:3]
The expression level of miR-486-5p in human cervical cancer serum and tissues were analyzed through quantitative RT-PCR. [score:3]
Overexpression of miR-486-5p in another cervical cell line (SiHa) stimulated cell proliferation, colony formation, migration, and invasion in vitro. [score:3]
The expression level of miR-486-5p was assessed by the relative quantification method with U6 as the reference gene (RQ = 2 [-ΔΔCt]). [score:3]
Some reports suggest that miR-486-5p is a tumor suppressor in lung cancer [14] and gastric adenocarcinoma [13], while others indicate that it is oncogenic in myeloid leukemia of Down syndrome [11] and chronic myeloid leukemia [12]. [score:3]
b miR-486-5p expression in cervical cancer patients’ cancer tissues (Cancer) and adjacent normal tissues (Adjacent). [score:3]
miR-486-5p expression was 18.56-fold higher in cervical cancer patients’ sera than in healthy donors’ sera (P < 0.001, Fig.   1a) and 10.40-fold higher in tumor tissues from cervical cancer patients than in adjacent normal tissues (P < 0.001, Fig.   1b). [score:3]
MiR-486-5p activates the PI3K-Akt pathway by directly inhibiting PTEN. [score:3]
a miR-486-5p expression in HeLa cells and SiHa cells. [score:3]
Similarly, the invasiveness of miR-486-5p inhibitor–transfected HeLa cells on the transwell assay was significantly lower than that of Mock -transfected control cells (P < 0.01; Fig.   4e-f), whereas the invasiveness of miR-486-5p mimic–transfected SiHa cells was significantly greater than that of controls (P < 0.01; Fig.   4g-h). [score:2]
For the luciferase activity assay, nucleotides 710 to 730 (the complete predicted miR-486-5p target site) of the PTEN 3′-UTR were inserted downstream of the Renilla luciferase gene in a Renilla/firefly luciferase reporter plasmid, psiCHECK-2 (GenePharma, Shanghai, China). [score:2]
d ROC analysis of the serum miR-486-5p expression assay results for cervical cancer patients vs healthy subjectsWe assessed the correlation between serum miR-486-5p concentration and four clinicopathologic factors in the cervical cancer patients: age, human papillomavirus infection status, tumor histologic type, and therapies received. [score:2]
MiR-486-5p transfection and expression in cervical cancer cells. [score:2]
Compared to control subjects, miR-486-5p was significantly overexpressed in cervical cancer patients’ serum and tissues. [score:2]
d ROC analysis of the serum miR-486-5p expression assay results for cervical cancer patients vs healthy subjects We assessed the correlation between serum miR-486-5p concentration and four clinicopathologic factors in the cervical cancer patients: age, human papillomavirus infection status, tumor histologic type, and therapies received. [score:2]
MiR-486-5p has been shown to be aberrantly expressed in many cancers, including myeloid leukemia [11, 12], gastric adenocarcinoma [13], and lung cancer [14], but its function in cancer is still not fully understood. [score:2]
MiR-486-5p expression was 13.88-fold higher in HeLa cells than in SiHa cells (P < 0.001, Fig.   2a). [score:2]
In colony formation assays performed to determine cell viability and proliferation activity, the number of colonies formed by HeLa cells transfected with miR-486-5p inhibitor was markedly lower than the number of colonies formed by Mock -transfected control cells (P < 0.05; Fig.   3c-d), while the number of colonies formed by miR-486-5p mimic -transfected SiHa cells was significantly greater than that formed by controls (P < 0.01; Fig.   3e-f). [score:2]
MiR-486-5p is overexpressed in cervical cancer patients’ sera and tissues. [score:2]
MiR-486-5p is expressed in cervical cancer cell lines. [score:2]
In contrast, transfection of miR-486-5p mimic into SiHa cells increased miR-486-5p expression by 10.92-fold compared with Mock -transfected controls (P < 0.01; Fig.   2c). [score:2]
The clinical significance of miR-486-5p in cancer remains largely unknown. [score:1]
The scramble oligonucleotides (negative control) and hsa-miR-486-5p mimic (miR-486-5p mimic) were synthesized by GenePharma. [score:1]
Both mouse and human have the same sequences of mature miR-486-5p and PTEN 3′-UTR. [score:1]
293 T cells were transfected with 0.5 μg of reporter plasmids per well plus scramble oligonucleotides or miR-486-5p mimic. [score:1]
Our results also reveal miR-486-5p to be an oncogenic miRNA that stimulates cell proliferation, migration, invasion, and tumor growth in cervical cancer. [score:1]
Our findings implicate serum miR-486-5p as a novel molecular biomarker that may provide effective approaches to both diagnosis and treatment in cervical cancer. [score:1]
c- d SiHa cells were transfected with miR-486-5p mimic (Mimic) or control miRNA (Mock). [score:1]
Akt Protein kinase B FBS Fetal bovine serum miR-486-5p microRNA-486-5p PBS Phosphate-buffered saline solution PI3K Phosphatidyl Inositol 3-kinase PTEN Phosphatase and tensin homolog RT-PCR Real-time quantitative polymerase chain reaction We thank Ruihao Wu for sample collection and Huaibin Zhou, Jindan Wang, Binjiao Zheng, Danli Xie, and Chaowei Wen for technical assistance. [score:1]
The wound closure rates of miR-486-5p mimic–transfected SiHa cells 24 h, 48 h, and 72 h after scratching were 14.91%, 37.81%, and 47.38% higher, respectively, than those of cells transfected with Mock control plasmid (P < 0.05, P < 0.01, and P < 0.01, respectively; Fig.   4c-d). [score:1]
In both univariate analysis and multivariate analyses, none of these factors was significantly correlated with higher serum concentration of miR-486-5p in these patients (Table  1). [score:1]
With an AUC = 0.90, serum miR-486-5p qualifies as a diagnostic biomarker for cervical cancer (P < 0.01, Fig.   1d). [score:1]
Previous studies have shown that activation of miR-486-5p blocked PTEN, thus leading to Akt phosphorylation in both mouse and human [17, 18]. [score:1]
Because there has been no study on miR-486-5p function in cervical cancer, our purpose here was to investigate the biological functions of this miRNA and their potential underlying mechanisms in this disease. [score:1]
We demonstrate for the first time that serum miR-486-5p has diagnostic potential in cervical cancer. [score:1]
Cervical cancer miR-486-5p Pten PI3K/Akt Around the world, cervical cancer is the fourth most common cancer among women, accounting for an estimated 529,572 diagnosed new cases and 274,967 deaths each year [1]. [score:1]
We conclude from these results that miR-486-5p functions as an oncogenic miRNA in cervical cancer. [score:1]
Cells transfected with miR-486-5p mimic had 60% lower luciferase activity than the control plasmid (P < 0.01; Fig.   5b). [score:1]
MiR-486-5p is a candidate regulator of phosphatase and tensin homolog (PTEN) in silico. [score:1]
The binding was specific, because the luc-reporter vector was not affected by the control miRNA, and the control vector was not affected by the miR-486-5p mimic (P = 0.64; Fig.   5b). [score:1]
This indicates that miR-486-5p could be an independent biomarker to diagnose cervical cancer. [score:1]
[1 to 20 of 87 sentences]
3
[+] score: 214
We observed that treatment with TGF-β1 up-regulated the expression of α-SMA, Fn and CTGF and that this expression was enhanced in the anti-miR-486-5p -transfected cells (Fig. 4C,D). [score:8]
To further determine if miR-486-5p down-regulation is sufficient to promote fibrogenesis in mouse fibroblasts, we knocked down miR-486-5p expression in mouse fibroblasts (NIH/3T3 cells). [score:7]
Insulin-like growth factor 1 (IGF-1), a positive regulator of the Akt-signaling pathway, is down-regulated by miR-486-5p in muscle cells directly 28. [score:6]
TGF-β1 down-regulates miR-486-5p expression in lung fibroblasts. [score:6]
Additionally, the down-regulation of miR-486-5p was reportedly responsible for both tumor progression and metastasis by relieving the inhibition of protumorigenic ARHGAP5 in lung cancer 33. [score:6]
Furthermore, transfecting NIH/3T3 cells with miR-486-5p decreased SMAD2 protein expression (Fig. 6C), demonstrating that SMAD2 is targeted by miR-486-5p directly. [score:6]
These results support the hypothesis that miR-486-5p exerts its anti-fibrotic effects by suppressing collagen synthesis and targeting SMAD2 directly. [score:6]
Our study indicates that miR-486-5p expression is frequently reduced in lung fibrotic diseases and may act as an anti-fibrotic effector in the development of pulmonary fibrosis. [score:6]
The results point to a novel approach for treating fibrotic diseases such as silicosis and IPF, for which cures have long proven elusive, by using therapeutics that specifically target miR-486-5p. [score:5]
For example, PTEN, a major negative regulator of the PI3-kinase pathway, which regulates growth, survival and proliferation, is targeted by miR-486-5p in muscle cells 28. [score:5]
Moveover, the TargetScan database predicts that Col6α6 is a potential target of miR-486-5p. [score:5]
The mature miR-486-5p mimics (miR-486-5p), control mimics (miR-NC), miR-486-5p inhibitors (anti-miR-486-5p) and control inhibitors (anti-miR-NC) were designed and synthesized by RiboBio Co. [score:5]
Decreased expression of miR-486-5p was observed in both silica- and BLM -induced mouse mo dels of lung fibrosis, and miR-486-5p expression was decreased in tissue samples from patients with silicosis and IPF. [score:5]
miR-486-5p overexpression also reduced α-SMA expression in the fibrotic lungs, which suggests that miR-486-5p diminishes myofibroblast differentiation (Fig. 2). [score:5]
To further explore if miR-486-5p down-regulation is required for fibrogenesis in mouse fibroblasts, NIH/3T3 cells were transfected with either miR-486-5p mimics or control mimics (miR-NC) for 48 hours and then treated with TGF-β1 for another 24 hours. [score:4]
All these data indicate that down-regulation of miR-486-5p contributes to pulmonary fibrosis. [score:4]
Our data indicate that miR-486-5p has an impact on the development of lung fibrosis partly by targeting SMAD2, which is one of downstream molecules of the TGF-β1 signaling pathway. [score:4]
Additionally, miR-486-5p is located within a CpG island on chromosome 2q35, so epigenetic silencing via either DNA methylation or histone deacetylation may also be responsible for miR-486-5p down-regulation 33. [score:4]
The loss of heterozygosity in this region may result in the down-regulation of miR-486-5p. [score:4]
As shown in Fig. 4A,B, over -expression of miR-486-5p in the fibroblasts decreased TGF-β1 -induced α-SMA, Fn and CTGF expression at both the protein and the mRNA levels compared with the control mimics (Fig. 4A,B). [score:4]
There are several possible reasons for the down-regulation of miR-486-5p that we observed in fibrotic lung tissues. [score:4]
SMAD2 is a direct target of miR-486-5p. [score:4]
These findings demonstrate that miR-486-5p has a strong anti-fibrotic activity in lung tissues and may be a novel target in the treatment of pulmonary fibrosis. [score:3]
Moreover, treating mouse fibroblasts (NIH/3T3 cells) with TGF-β1 resulted in increased mRNA expression of the myofibroblast differentiation markers Fn and α-SMA and decreased levels of miR-486-5p (Fig. 3). [score:3]
The lung tissues obtained from the patients with either silicosis or IPF also exhibited decreased miR-486-5p expression (Fig. 1E). [score:3]
We found that miR-21, miR-455, miR-151-3p, miR-486-5p and miR-3107 were differentially expressed in a BLM -induced mouse mo del of pulmonary fibrosis (Fig. 1C). [score:3]
To determine whether miR-486-5p could directly regulate SMAD2, we cloned part of the 3′UTR of SMAD2 into a luciferase reporter construct (the psiCHECK-2 reporter). [score:3]
One potential explanation is that miR-486-5p is located on chromosome 8p11.21, a genomic region containing several potential tumor-suppressor genes that is frequently deleted in a variety of cancers 47. [score:3]
Having demonstrated that miR-486-5p was decreased in two mouse mo dels of lung fibrosis as well as human silicosis and IPF, we next explored whether restoring miR-486-5p expression may have therapeutic potential. [score:3]
Co-transfection with miR-486-5p significantly reduced the normalized luciferase activity for the reporter containing the wild type, but not the mutant, suggesting that SMAD2 is directly regulated by miR-486-5p. [score:3]
Moreover, our data indicate that over -expression of miR-486-5p attenuated pulmonary fibrosis in mice and repressed TGF-β1 -induced fibrogenesis in NIH/3T3 cells. [score:3]
The present study is the first to show that administration of miR-486-5p mimics may help to attenuate the fibrotic processes associated with lung disease. [score:3]
Furthermore, OLFM4 was recently proposed to be a biologically relevant miR-486-5p target in gastric cancer 49. [score:3]
Therefore, inhibition of SMAD2 may not be the sole mechanism by which miR-486-5p exerts its anti-fibrogenic effects. [score:3]
Increased IGF-1expression was observed in the lung tissues of BLM -treated C57BL/6 mice 5. The studies mentioned above suggest that IGF-1may also be associated with the anti-fibrotic effects of miR-486-5p. [score:3]
In the present study, decreased miR-486-5p expression was linked to the progression of pulmonary fibrosis in both humans and mice. [score:3]
However, decreased cell numbers were observed in the cells transfected with the miR-486-5p mimics but not in the cells transfected with miR-NC, indicating that miR-486-5p successfully suppressed the TGF-β1 -induced proliferation of fibroblasts (Fig. 5A). [score:3]
miR-486-5p overexpression had a similar effect in the BLM group (P < 0.001). [score:3]
Increased miR-486-5p expression attenuates experimental pulmonary fibrosis. [score:3]
miR-21, miR-455, miR-151-3p, miR-486-5p and miR-3107 were differentially expressed in mouse fibrotic lung tissues. [score:3]
MiR-486-5p is down-regulated in the lung tissues of patients with silicosis and IPF, as well as serum from patients with silicosis. [score:3]
Therefore, miR-486-5p may represent a primary pathogenic mechanism underlying the development of lung fibrosis. [score:2]
In serum samples obtained from patients with silicosis, miR-486-5p expression was significantly decreased in all cohorts (stages I, II and III, P < 0.05) compared with the control subjects (Fig. 1D). [score:2]
Accordingly, we observed that miR-486-5p post-transcriptionally regulates Col6α6 in lung fibroblasts (Figure S3). [score:2]
A 3′UTR mutant with mutations in the predicted miR-486-5p site was also cloned into a psiCHECK-2 reporter. [score:2]
Consequently, given its broad involvement in fibrotic signaling events, targeting miR-486-5p in patients with silicosis and IPF may represent a superior therapeutic strategy compared with approaches aimed at a single pathway. [score:2]
Five miRNAs, miR-21, miR-455, miR-151-3p, miR-486-5p and miR-3107, were validated to be dysregulated in the lung tissues from mice with silica -induced fibrosis (n = 6 per group) (Fig. 1B). [score:2]
Additionally, miR-486-5p expression was decreased in serum samples from patients with silicosis, as well as the lung tissues of patients with either silicosis or IPF, compared with healthy donors. [score:2]
miR-486-5p regulates fibrogenesis in fibroblasts. [score:2]
miR-486-5p is generated by processing intronic RNA from the Ank1 gene 28. [score:1]
Next, we examined the effects of miR-486-5p on cell-cycle progression in NIH/3T3 cells and observed a significant increase in S phase and a decrease in G1 phase after TGF-β1 treatment. [score:1]
The human miR-486-5p precursor generates two mature miRNAs: miR-486-5p and miR-486-3p. [score:1]
miR-486-5p is highly conserved among mammals, and no miR-486 sequence has been identified within the genomes of non-mammalian species such as fishes or birds, even though these species contain the Ank1 gene sequence 31. miR-486 is located at Chr:8p11, a region of frequent genomic loss in multiple cancers 32. [score:1]
Alterations in lesion severity and distribution in lungs in response to treatment with miR-486-5p. [score:1]
time 0. (A) Mouse fibroblasts (NIH/3T3 cells) were transfected with either 50 nM of control mimics (miR-NC) or 50 nM of the miR-486-5p mimics. [score:1]
The expression of mature miRNAs was assayed using TaqMan MicroRNA Assays (Applied Biosystems, Foster City, CA) specific for hsa-miR-486 (ID 001278), hsa/mmu-miR-21a (ID 000397), hsa-miR-455 (ID 001280), hsa-miR-151-3p (ID 002254), mmu-miR-1a (ID 002222), mmu-miR-133b (ID 002247), mmu-miR-5128 (ID 462199_mat), mmu-miR-223 (ID 002295), mmu-miR-146b (ID 001097), mmu-miR-133a (ID 001637), mmu-miR-449a (ID 001030), mmu-miR-122 (ID 002245), mmu-miR-351-3p (ID 464446_mat), mmu-miR-193a-5p (ID 002577), mmu-miR-151-3p (ID 001190), mmu-miR-574-3p (ID 002349), mmu-miR-3107/486 (ID 001278). [score:1]
Mouse fibroblasts (NIH/3T3 cells) were treated with TGF-β1 (either 1 ng/ml or 2 ng/ml) for 0, 24, or 48 h. The RNA was isolated, and the levels of miR-486-5p, fibronectin (Fn) and α-SMA were determined by real-time PCR. [score:1]
The control mimics plus silica/BLM (10 mg/kg agomiR-NC plus either 50 mg/kg silica or 1.5 U/kg BLM in 50 μl saline) and the miR-486-5p mimics plus silica/BLM (10mg/kg agomiR-486-5p plus either 50 mg/kg silica or 1.5 U/kg BLM in 50 μl saline) were administered intratracheally. [score:1]
At 48 hours post-transfection with miR-486-5p, the cells were treated with TGF-β1 for 24 hours. [score:1]
For miR-486-5p treatment, control mimics plus silica/bleomycin (10 mg/kg of agomiR-NC plus either 50 mg/kg of silica or 1.5 U/kg of bleomycin in 50 μl of saline) and the miR-486-5p mimics plus silica/bleomycin (10 mg/kg of agomiR-486-5p plus either 50 mg/kg of silica or 1.5 U/kg of bleomycin in 50 μl of saline) were administered intratracheally. [score:1]
miR-486-5p represses the TGF-β1 -induced proliferation of fibroblasts. [score:1]
The constructs were subsequently transfected into NIH/3T3 cells with either miR-486-5p mimics or control mimics (miR-NC)(Fig. 6B). [score:1]
NIH/3T3 cells were transfected with either the miR-486-5p mimics or miR-NC. [score:1]
These data suggest that decreased miR-486-5p is required for fibrogenesis. [score:1]
The cells were serum-starved the following day and transfected with 50 nM of either the miR-486-5p mimics or the negative controls. [score:1]
These effects were restored by miR-486-5p, which suggests a role for miR-486-5p in repressing TGF-β1 -induced proliferation by increasing the number of cells in S phase and decreasing the cell-cycle arrest (Fig. 5B). [score:1]
The miR-486-5p mimics restored the effects on the cell cycle (n = 3). [score:1]
We also sought to illustrate whether miR-486-5p interferes with TGF-β1 -induced proliferation in NIH/3T3 cells. [score:1]
However, until now there has been no evidence that miR-486-5p decreases lung fibrosis. [score:1]
Briefly, at 48 h post-transfection with either the miR-486-5p mimics or the control mimics (50 nM), the NIH/3T3 cells were collected via trypsinization and washed with phosphate-buffered saline (PBS). [score:1]
The cholesterol-conjugated miR-486-5p mimics and negative controls (agomiR-486-5p and agomiR-NC, respectively) were purchased from RiboBio Co. [score:1]
Uniquely, miR-486-5p was decreased not only in fibrotic lung tissues but also in serum from patients with silicosis. [score:1]
These data suggested that decreased miR-486-5p is sufficient to promote fibrogenesis in mouse fibroblasts. [score:1]
The NIH/3T3 cells were plated in 24-well plates and co -transfected using Lipofectamine 2000 (Invitrogen) with 200 ng of psiCHECK-2 and either miR-486-5p or miR-NC at different concentrations. [score:1]
In addition, the seed sequence of miR-486-5p within the 3′UTR sequence of mouse SMAD2 was predicted to be a potential conserved binding site (Fig. 6A). [score:1]
To address this question, we administered either silica or BLM together with either control mimics or miR-486-5p mimics to mice intratracheally. [score:1]
The mutated nucleotides located within the miR-486-5p -binding site are underlined. [score:1]
[1 to 20 of 77 sentences]
4
[+] score: 157
Of note, recently mir-486-5p has been reported as a tumor suppressor in lung cancer directly targeting components of insulin growth factor (IGF) signaling, such as p85α, and its expression has been proved to be regulated by p53 [31]. [score:9]
To demonstrate that mir-486-5p up-regulation is fundamental for mir-660-5p anti-tumoral effects we inhibited mir-486-5p after mir-660 over -expression, then migration and proliferation in both lung cancer cell lines were analyzed. [score:8]
To demonstrate that p53 and mir-486-5p up-regulation after MDM2 silencing could regulate their downstream genes, mRNA and protein levels of p21 [WAF1/CIP1], a cyclin -dependent kinase inhibitor, were also analyzed in the same cells. [score:7]
mir-486-5p up-regulation, as illustrated by Figure 4A, after mir-660-5p over -expression was absent in A549 p53 [−/−] cells, compared to wild-type cells, whereas the expression level of mir-660-5p remained almost unaffected in both A549 wild-type and A549 p53 [−/−] cells (Figure 4B). [score:7]
Our results demonstrates that, in p53 wild-type lung cancer cells, mir-660-5p was able to indirectly regulate the expression of mir-486-5p, another miRNA that is de-regulated in aggressive forms of lung cancer, through the stabilization of p53. [score:6]
Furthermore, in this study, we showed that relatively small changes of mir-660-5p expression could potentially target several genes of redundant pathways, such as mir-486-PI3K/AKT signaling and, thus, potentially able to interfere with several pro-tumoral mechanisms. [score:5]
Successful inhibition of mir-486-5p levels after mir-660-5p over -expression is shown in Figure 2E. [score:5]
Following siRNA -mediated MDM2 inhibition, an increase of mir-486-5p, of approximately six-fold compared to control, was observed in A549 cells (Figure 3A), whereas mir-486-5p up-regulation was not identified in H1299 (Figure 3B). [score:5]
In order to prove that mir-486-5p regulation is effectively due to mir-660-5p levels in cells and its activity on p53 pathway, MDM2, which is, as we recently demonstrated, a direct target of mir-660-5p in lung cancer cells, was silenced. [score:5]
To further confirm the importance of mir-486-5p in the activity of mir-660-5p, proliferation after mir-660-5p over -expression and mir-486-5p inhibition was analyzed. [score:5]
Furthermore, ISH for mir-660-5p was positive only on A549 and H1299 over -expressing mir-660-5p areas, whereas A549 and H1299 over -expressing mir-486-5p were both negative (Figure 1D). [score:5]
Peng Y. Dai Y. Hitchcock C. Yang X. Kassis E. S. Liu L. Luo Z. Sun H. L. Cui R. Wei H. Insulin growth factor signaling is regulated by microRNA-486, an underexpressed microRNA in lung cancer Proc. [score:4]
After MDM2 restoration we did not observe any significant mir-486-5p up-regulation (Figure 3A). [score:4]
2.1. mir-486-5p Expression Level and Activity Are Positively Regulated by mir-660-5p in Lung Cancer Cells. [score:4]
Next, p85 expression level, a direct target of mir-486-5p, was measured in order to verify the activation of mir-486-5p signaling in different conditions. [score:4]
In conclusion, we introduce an additional component to an already complex pathway: mir-486-5p is positively regulated by mir-660-5p expression, through the mir-660-5p-MDM2-p53 pathway, in lung cancer cell lines. [score:4]
Our data proved a positive modulation of mir-486-5p after mir-660-5p restoration in A549 (wild-type p53), but not in H1299 (homozygous partial deletion of the TP53 gene resulting in a loss of expression of p53 protein), suggesting that a functional p53 protein is essential for mir-660-5p regulatory action on mir-486-5p. [score:4]
Following mir-660-5p over -expression, a great increase in mir-486-5p expression level in A549, about 60-fold compared to control, was observed. [score:4]
Together, these data confirm that mir-660-5p is responsible for mir-486-5p positive modulation through its direct targeting of MDM2 in p53 wild-type lung cancer cells. [score:4]
According to the mir-486-5p up-regulation, a down-modulation of p85 levels in real-time and Western blot analysis was detected (Figure 3C,D). [score:4]
These results suggest that, in lung cancer cell lines, mir-660-5p could regulate mir-486-5p expression level through a p53 dependent mechanism. [score:4]
Interestingly, mir-660-5p inhibited migratory ability of A549 cells, compared to control (migration reduction: 45% compared to control, p < 0.05) but following mir-486-5p inhibition, the anti-migratory effect of A549 miR-660-5p over -expressing cells were partially diminished (migration reduction: 30% compared to control, p < 0.05) (Figure 2A). [score:4]
The functional role of mir-660-5p-mir-486-5p was confirmed by p21 up-regulation and p85 reduction in the same cells. [score:4]
Interestingly, mir-660-5p knockdown showed a reduction of mir-486-5p expression in A549, whereas this effect was absent in H1299 cells (Figure 1A). [score:4]
In a previous study, our group reported that mir-486-5p was strongly down-regulated in primary lung tumors compared to paired normal tissues [30]. [score:3]
MDM2 Silencing Induces Increased Expression Level and Activity of mir-486-5p in Lung Cancer Cells. [score:3]
On the other hand, restoration of p53 in H1299 cells led to an approximately four-fold increase of mir-486-5p, after mir-660-5p over -expression (Figure 4D). [score:3]
No significant change was observed in mir-660-5p expression upon mir-486-5p modulation, neither in A549 nor in H1299 cell lines (Figure 1B). [score:3]
In H1299 cell lines mir-486-5p levels were unaffected after mir-660-5p over -expression (Figure 1A). [score:3]
As expected mir-486-5p staining was clearly visible inside both A549 and H1299 cells transfected with the mir-486-5p mimic, but also A549 cell line over -expressing mir-660-5p was positive for miR-486-5p ISH. [score:3]
As shown in Figure 2C, mir-660-5p significantly reduced A549 proliferation at 72 and 120 h post transfection compared to controls (40% of reduction in proliferation, p < 0.05), whereas the inhibition of mir-486-5p in the same cells resulted in a lower reduction of cell growth (21% of proliferation reduction, p < 0.05). [score:2]
Moreover, to confirm mir-660-5p and mir-486-5p mutual regulation, in situ hybridization (ISH) on cell-blocks of A549 and H1299 characterized by the over -expression of the two miRNAs was performed. [score:2]
Based on our data that demonstrate an important role of mir-660-5p in lung tumor suppression through the regulation of the p53/MDM2 negative feedback loop, we here investigate the relationship among mir-660-5p, p53 and mir-486-5p and their role in lung tumorigenesis. [score:2]
Interestingly, down-modulation of MDM2 mRNA and protein was also visible in H1299, but without stimulation of p21 transcripts or proteins, and without any modulation of p85, indicating that functional p53 is critical for the regulatory effect of the mir-660-mir-486 network (Figure 3C,D). [score:2]
The mir-660-mir-486 Regulatory Pathway Is p53-Dependent. [score:2]
In order to verify this hypothesis, we evaluated mir-660-5p-mir-486-5p cross-talk in A549 knockdown for p53 (A549 p53 [−/−]), obtained using Clustered Regularly Interspaced Short Palindromic Repeats CRISPR/cas9 technology, and in H1299 restored for p53 expression (H1299-p53). [score:2]
On the contrary, H1299-mir-660-5p did not show positive staining for mir-486-5p (Figure 1C). [score:1]
When mir-486-5p was over-expressed in cells, the p85 mRNA levels decreased in either A549 or H1299 (about 40% and 30% of reduction, respectively, compared to control) (Figure 1E) and p85 protein levels decreased accordingly (40% reduction for A549 and 22% for H1299, compared to control) (Figure 1F). [score:1]
This finding supports our results and indicates that mir-660-5p and mir-486-5p are critical players in the PI3K-–AKT-MDM2p53 network, a fundamental pathway in such cancers as leukemia, breast and lung tumors. [score:1]
A549 and H1299 cell lines were transiently transfected with a commercial MDM2 siRNA and then mir-486-5p modulation was assessed. [score:1]
2.2. mir-486-5p Modulation Is Important for mir-660-5p Antitumoral Effects. [score:1]
To investigate the relationship between mir-486-5p and mir-660-5p in lung cancer cells, we transiently transfected two lung cancer cell lines with different genotypes (A549 and H1299), p53 wild-type and null, respectively, using commercially available miRNA mimics or inhibitors. [score:1]
These data prove that p53 is an essential component in the mir-660-5p and mir-486-5p interplay. [score:1]
Therefore we demonstrated that mir-486-5p is positively modulated and activated by mir-660-5p restoration in lung cancer cell lines, but only in a context of a functional p53 pathway. [score:1]
[1 to 20 of 44 sentences]
5
[+] score: 87
While miR-486 has been reported as highly expressed in blood cells [40, 41], our results on miR-486 expression in neuronal cells are supported by two other reports that found miR-486 expressed in motor neurons [42] and iPSC-generated dopaminergic neurons [41, 43]. [score:7]
We found that miR-486 was expressed in OE neurons by histologic analysis, and miR-486 inhibited neuron production in a primary culture over -expression assay. [score:6]
Using a probe for miR-486, the most strongly downregulated miRNA identified in our arrays, we found that miR-486 expression localized selectively to the olfactory neuron layers of the OE in normal unlesioned adult mouse nasal tissue sections (Fig 3A). [score:6]
While miR-3141 expression trended towards enrichment in c-Kit (+) cells but was variable among qPCR samples, miR-486 was significantly downregulated in the basal cells, and was therefore selected for further study. [score:6]
Interestingly, our results are in line with a report showing that up-regulation of miR-486 following spinal cord injury promoted neurodegeneration, by suppressing NeuroD6 [42]. [score:6]
We found that miR-486 was enriched in the non-progenitor fraction and its forced over -expression in vitro in c-Kit (+) progenitor globose basal cells (GBCs) has an inhibitory effect on mature neuron production. [score:5]
Using an in vitro functional assay, we found that miR-486 over -expression suppressed the neuronal differentiation of basal progenitor cells. [score:4]
Our functional results are in line with a study showing that up-regulation of miR-486 following spinal cord injury promoted neurodegeneration [42]. [score:4]
Comparison of the staining patterns from Fig 3A and 3B versus Fig 3D and 3E indicates that in the OE miR-486 is expressed in the neuronal layers apical to the c-Kit (+) basal cells. [score:3]
Over -expression of miR-486 in olfactory basal cell-derived cultures reduces neurogenesis. [score:3]
As expected, at high magnification miR-486 expression was noted to be absent from the basal cell layers, where c-Kit (+) cells are localized, and was also found to be absent from the apical sustentacular cells layer (Fig 3B). [score:3]
In situ hybridization was performed on normal adult mouse olfactory epithelium tissue sections; a miR-486 probe (A, B) reveals expression by cells throughout the neuronal layers (Neu), with little signal in the underlying lamina propria. [score:3]
The observed expression of miR-486 in the immature and mature olfactory neuron layers is consistent with our microarray and qPCR results, providing validation of these data sets. [score:3]
Bar = 20μm in A, 120μm in C and D. Cultures were used to assay for the effect of over -expression of miR-486 (Fig 4C–4F). [score:2]
Bar = 20μm in A, 120μm in C and D. Cultures were used to assay for the effect of over -expression of miR-486 (Fig 4C–4F). [score:2]
Thus, in this assay, miR-486 over -expression reduces neurogenesis. [score:2]
We validated miR-486 enrichment in the c-Kit (-) population, and found it to have an inhibitory effect on neuronal production in a culture assay. [score:2]
MiR-486 is selectively expressed in olfactory neurons. [score:2]
We interpret these results as consistent with a possible feedback regulatory role for miR-486 on olfactory precursor cell differentiation, since no effect on proliferation was identifiable. [score:2]
Of interest, all cultures produced Tuj1 (+) neurons; however, we repeatedly identified approximately a 30% reduction in the percentage of neurons arising in the miR-486 -transfected cultures (p = 0.0014), normalizing to control cultures (Fig 4F). [score:1]
Although there was no significant change in proliferation by EdU incorporation (E), miR-486 treatment reduced the total amount of TUJ1 positive neurons by 30.05% ± 5.88 (p = 0.0014) normalized to scrambled control group (F); n = 8, mean ± S. E. M; student’s t-test. [score:1]
Comparing cultures transfected with either miR-486 or a scrambled control (n≥3 samples per group), we quantified cell number, neurons, and incorporation of a 1 hour pulse of EdU to assess proliferation. [score:1]
Culture composition is quantified in (B), n = 3. (C, D) Cultures were transfected after 24 hours with either miR486 or a scrambled control RNA. [score:1]
For each experiment, the percentage of TUJ1 -positive neurons (cells with round soma and neurite-like processes) from miR-486 or scrambled- transfected cells from each coverslip was normalized to the averaged values for the scramble control. [score:1]
Furthermore, miR-486, the most highly enriched miRNA in the non-progenitor pool, was chosen for additional study. [score:1]
Labeling tissue sections using these markers provides further context for the assessment of the miR-486 labeling pattern. [score:1]
Confirmation by in situ hybridization for miR-486 enrichment in the c-Kit (-) population. [score:1]
Two miRNAs were selected for validation by qPCR (Fig 2C): miR-3141, enriched in basal cells, and miR-486, enriched in the c-Kit (-) fraction. [score:1]
As such, it is possible that miR-486 could function analogously in the OE, via interacting with NeuroD. [score:1]
3’ and 5’-double-digoxigenin labeled LNA probes for miR-486-5p (CTCGGGGCAGCTCAGTACAGGA), or a scrambled negative control (GTGTAACACGTCTATACGCCCA), were obtained from Exiqon (Woburn, MA). [score:1]
Here, we used a 3-day culture system seeding adult mouse basal cells harvested from regenerating OE, since miR-486 was identified from adult OE tissue. [score:1]
No difference in EdU labeling was identified, comparing scramble or miR-486 treated cultures (Fig 4E). [score:1]
Functional effects of miR-486 in c-Kit-sorted progenitor basal cell culture preparations. [score:1]
Cells were transfected 24 hours later with either 10 nM miR-486 or scrambled control miRNA from Exiqon (Woburn, MA) using Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific) according to manufacturer’s instructions. [score:1]
0187576.g003 Fig 3Confirmation by in situ hybridization for miR-486 enrichment in the c-Kit (-) population. [score:1]
[1 to 20 of 35 sentences]
6
[+] score: 78
Other miRNAs from this paper: mmu-mir-486a, mmu-mir-543
Huang et al. demonstrated that miR-486-5p was downregulated in HCC; miR-486-5p suppressed HCC growth, migration and invasion by targeting PIK3R1 [31]. [score:8]
In general, miR-543 was upregulated and miR-486-5p was downregulated in the HCC cells compared to the LO2 cells (Figure 5C & Supplementary Figure 1). [score:6]
Further, we analyzed the 48 matched pairs of HCC and normal adjacent liver tissue samples by qRT-PCR to determine miR486-5p expression and found it to be significantly downregulated in HCC tissues (Figure 5F). [score:6]
Therefore, enforced expression of miR-486-5p can be a potential therapeutic strategy for HCC patients with NEK2 high expression and needs to be explored further. [score:5]
Aberrant expression of miR-486-5p is associated with different types of diseases. [score:5]
Hence, we validated definitively that NEK2 was a direct target of miR-486-5p. [score:4]
Finally, we identified miR-486-5p as an upstream regulator of NEK2 expression, thereby potentially opening up a future therapeutic avenue to alleviate HCC progression. [score:4]
Also, miR-486-5p is significantly downregulated in non-small-cell lung cancer (NSCLC) and NSCLC cell lines resulting in tumor progression and metastasis [30]. [score:4]
Therefore, we analyzed mRNA target-predicting algorithms, miRanda and miRDB to identify potential miRNAs that bind to 3′ UTR of NEK2 and identified miR-543 and miR-486-5p as possible candidates (Figure 5A, 5B). [score:3]
To establish the role of miR-486-5p in regulating NEK2 expression, we transfected HCC cells with miR-486-5p or mutant miR-486-5p mimics and luciferase tagged NEK2-3′ UTR and analyzed the effects after 48h by luciferase reporter assay. [score:3]
Inhibition of miR-486-5p in colorectal carcinoma cells enhances tumor growth and lymphangiogenesis [29]. [score:3]
Also, there was an inverse correlation between the expression of miR-486-5p and NEK2 in HCC tissues (Figure 5G). [score:3]
In this study, we identified that miR-486-5p directly regulated NEK2 by binding to its 3′ UTR. [score:3]
We observed that the miR-486-5p mimics attenuated luciferase activity of NEK2-3′ UTR whereas the mutant miR-486-5p mimics did not suppress NEK2-3′ UTR luciferase activity (Figure 5E). [score:3]
NEK2 is a target for miR-486-5p in HCC cells. [score:3]
IHC analysis revealed that NEK2 levels were low in high miR-486-5p expressing tissues and conversely tissues with high NEK2 had diminished levels of miR-486-5p (Figure 5H). [score:3]
Next, we analyzed the expression levels of miR-543 and miR-486-5p in normal liver cell LO2 and HCC cell lines, namely, SMMC-7721, Hep3B and HepG2 by qRT-PCR. [score:3]
MiR-486-5p targets NEK2. [score:2]
Therefore, these results demonstrated that NEK2 was regulated by miR-486-5p and is potential consequential for HCC patient outcomes. [score:2]
Therefore, we postulated that miR-486-5p was potential critical upstream negative regulator of NEK2 that maybe relevant for cancer therapy. [score:2]
DNA fragments from the 3′-UTR of NEK2 that contained the predicted complementary sites of miR-486-5p were cloned into a pGL3-basic vector (Addgene, Cambridge, USA). [score:1]
MiR-486-5p and mutant miR-486-5p mimics were purchased from RiboBio (Guangzhou, China). [score:1]
Then, the pGL3-NEK2-3′UTR reporter plasmids (100ng) plus 5ng of pRL-TK renilla plasmid (Promega, Madison, USA) and increasing levels (10nM and 50 nM) of negative control (NC), miR-486-5p or mutant miR-486-5p mimics were co -transfected into the HCC cells using the Lipofectamine LTX reagent (Invitrogen, Carlsbad, USA) according to the manufacturer's instructions. [score:1]
[1 to 20 of 23 sentences]
7
[+] score: 69
Other miRNAs from this paper: mmu-mir-486a
We also examined the effect of DNA methylation inhibition on miR-486 expression on cells with methylation of the ANK1 promoter region that do not normally express ANK1 (HPDE and HPNE) as well as cells that normally express ANK1 (Figure 4B). [score:9]
We find that in HPDE and HPNE cells where both ANK1 and miR-486 are silenced, DNA methylation inhibition also induces expression of miR-486, whereas in Panc-1 cells which have an unmethylated ANK1 promoter region and expression of both ANK1 and miR-486 there was a mild reduction in miR-486 expression (Figure 4C). [score:9]
We examined the expression of miR-486-3p and miR-486-5p in pancreatic cancer cell lines and its relationship to ANK-1 expression and found a tight correlation, consistent with co -expression (Figure 4). [score:7]
To further examine this relationship, we examined miR-486 expression in cells with ANK1 knockdown and show that like ANK1, miR-486 expression is significantly reduced in these cells. [score:6]
C. The effect of DNA methylation inhibition with 5-deoxycytosine on the expression of ANK1, miR-486-3p and miR-486-5p. [score:5]
Although miR-486 is overexpressed in pancreatic cancer [26, 27], it likely has a limited role as a circulating diagnostic marker because of the abundant expression of miR-486 in erythrocytes. [score:5]
B. The effect of ANK1 knockdown on miR-486-3p and miR-486-5p expression. [score:4]
Consistent with this, miR-486 expression in erythrocytes is regulated by GATA1 binding to the ANK1 promoter [25]. [score:4]
Figure 4 A. Pancreatic cell line expression of ANK1, miR-486-3p and miR-486-5p. [score:3]
We also found that miR-486 is located in the coding region of ANK1 suggesting that miR-486 is co-expressed with ANK1 in pancreatic cancer cells. [score:3]
A. Pancreatic cell line expression of ANK1, miR-486-3p and miR-486-5p. [score:3]
Co -expression of ANK1 and miR-486 in pancreatic cell lines. [score:3]
Prior studies have found that miR-486 promotes growth of myeloid cells [25, 28], raising the possibility that its co -expression with ANK1 could also promote pancreatic cancer growth. [score:3]
We also found evidence that miR-486 which is located in the ANK1 coding region was co-expressed with ANK1. [score:3]
MiR-486 has been reported to be overexpressed in pancreatic cancer cells and in pancreatic precursor neoplasms [26, 27]. [score:2]
[1 to 20 of 15 sentences]
8
[+] score: 69
We find that miR-222 expression is markedly up-regulated in GRMD dog muscle compared to healthy dog, while miR-486 tends to be down-expressed. [score:7]
In accordance with previous observations made in the mdx mouse mo del and DMD patients [10, 22, 25, 26], we find that miR-222 and miR-486 exhibit a marked up-regulation and a down-regulation in 9-month-old GRMD dog muscle, respectively. [score:7]
Firstly, it is surprising that the expression levels of miR-206 and miR-486 (two miRNAs known to be implicated in the regenerative process) are not up-regulated in transplanted GRMD dogs. [score:6]
We successfully performed in situ exploration of two of the five miRNA tested: miR-206, a key modulator of skeletal muscle development and disease, and miR-486, an important factor in the regulation of DMD muscle pathology (Fig.   1b). [score:5]
In the dystrophic context, we observe a markedly increased expression of miR-222 (p = 0.03) and a tendency to decreased expression of miR-486 (p = 0.14) (Fig.   1a). [score:5]
We show that miR-133a (p = 0.03) and miR-222 (p = 0.03) are up-regulated in GRMD [MuStem] dogs compared to mock GRMD dogs (Fig.   4a), while miR-1, miR-206 and miR-486 expressions appear unchanged. [score:5]
In healthy dog muscle, miR-206 and miR-486 are expressed around some peripheral nuclei of fibres as well as in endothelial cells. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in muscles (right and left Biceps femoris) of three 9-month-old GRMD and six mock GRMD dog by real-time PCR and normalized by RNU6B levels. [score:3]
Lower panel: miR-486 expression. [score:3]
We point out a differential muscle expression of miR-222 and miR-486 associated with the pathophysiology of the clinically relevant GRMD dog mo del with a tissue localization focused on regenerated fibres. [score:3]
In terms of tissue distribution, the ISH carried out on the Biceps femoris muscle of GRMD [MuStem] dog reveals an expression of miR-486 and miR-206 on clustered MyHCd [+] regenerative fibres (Fig.   4b), which confirms previous findings [33, 34] and reinforces the hypothesis whereby these two miRNAs are unaffected by the infusion of cells. [score:3]
Expression levels of miR-1, miR-133a, miR-206, miR-222 and miR-486 were determined in 9-month-old healthy (n = 5) and GRMD (n = 3) dog muscle by real-time PCR and were normalized to RNU6B levels. [score:3]
Using in situ hybridization, we show that miR-206 and miR-486 are mainly expressed in clusters of newly regenerated fibres. [score:3]
For this reason, we aim at establishing, for the first time, a description of miRNA dysregulations in GRMD dog skeletal muscle based on a dedicated set: miR-1, miR-133a, miR-206, miR-222 and miR-486. [score:2]
Expression levels of miR-1, miR-133a, miR-206, miR-222, and miR-486 were determined in muscles (right and left Biceps femoris) of six 9-month-old GRMD [MuStem] dogs compared to six mock GRMD dogs. [score:2]
In healthy dog muscle, miR-486 is detected both in endothelial cells (black arrow) and around peripheral nuclei (empty arrow head). [score:1]
Interestingly, in GRMD dogs, miR-206 and miR-486 are mainly localized in newly formed myoblasts and regenerating fibres, as demonstrated by MyHCd [+] labelling on serial sections. [score:1]
In situ hybridization exploration reveals, for the first time, that miR-486 and miR-206 are mainly localized in newly regenerated fibres in GRMD dog muscle. [score:1]
In situ hybridization (ISH) was performed on muscles from healthy, GRMD, mock GRMD and GRMD [MuStem] dogs, using digoxigenin (DIG) -labelled miRCURY locked nucleic acid (LNA) detection probes (Exiqon, Vedbaek, Denmark), corresponding to hsa-miR-486 (38596–05), hsa-miR-206 (88081–15) and scramble-miR (99004–05 and 99004–15). [score:1]
miR-206 and miR-486 are detected in myoblasts (black arrow head) and in the cytoplasm of small and intermediate regenerating MyHCd [+] fibres (asterisk). [score:1]
Furthermore, most of the fibres display a perinuclear miR-486 signal. [score:1]
In situ hybridization In situ hybridization (ISH) was performed on muscles from healthy, GRMD, mock GRMD and GRMD [MuStem] dogs, using digoxigenin (DIG) -labelled miRCURY locked nucleic acid (LNA) detection probes (Exiqon, Vedbaek, Denmark), corresponding to hsa-miR-486 (38596–05), hsa-miR-206 (88081–15) and scramble-miR (99004–05 and 99004–15). [score:1]
Other miRNAs, such as miR-29, miR-34, miR-222 and miR-486, also play key-roles in modulating important pathways of skeletal muscle processes [19– 22]. [score:1]
In GRMD dog muscle, miR-486 is localized in myoblasts (black arrow head) and regenerating fibres (asterisk). [score:1]
[1 to 20 of 24 sentences]
9
[+] score: 47
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This approach proved effective at identifying several mRNAs whose relative levels of expression were positively correlated with that of their targeting miRNA(s), a subset of which are represented in Fig 9. These studies were therefore extended by employing a knockdown strategy in which an immortalized mouse caput epididymal epithelial cell line (mECap) was co -transfected with a cherry red reporter and miRNA mimics of either miR-200c, miR-486 (shown to be significantly up-regulated in the caput and caudal regions, respectively), or a scrambled negative control (mirVana). [score:9]
These candidate miRNAs included representatives that exhibited regulated patterns of expression from each of the two primary classes detected, namely: those with highest expression in the caput (let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p), or highest expression in the cauda (miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:8]
In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
0135605.g008 Fig 8In order to verify the next generation sequence data, nine differentially expressed miRNAs were selected for targeted validation using qRT-PCR, including representatives with highest expression in the proximal (caput: let-7c-5p, let-7b-5p, miR-375-3p, miR-9-5p, miR-467d-3p, and miR-200c-3p) and distal (cauda: miR-410-3p, miR-486-5p, and miR470c-5p) epididymis. [score:7]
As shown in Fig 10 this strategy proved effective in eliciting a significant reduction in the expression of both Mapk14 (targeted by miR-200c) (Fig 10A) and Foxo1 (targeted by miR-486) (Fig 10B) mRNA. [score:7]
It also highlighted the caput-specific expression of miR-9-5p, and confirmed a significant up-regulation of miR-486-5p and miR470c-5p between the caput and corpus epididymis. [score:6]
0135605.g010 Fig 10To confirm the functional significance of epididymal miRNAs, an immortalized mouse caput epididymal epithelial cell line (mECap) was co -transfected with a cherry red reporter and miRNA mimics of either (A) miR-200c, (B) miR-486, or a scrambled negative control (mirVana). [score:1]
To confirm the functional significance of epididymal miRNAs, an immortalized mouse caput epididymal epithelial cell line (mECap) was co -transfected with a cherry red reporter and miRNA mimics of either (A) miR-200c, (B) miR-486, or a scrambled negative control (mirVana). [score:1]
miRNA mimics of miR-200c-3p, miR-486-5p and a scrambled negative control (mirVana) were transfected separately at a concentration 5 nM using lipofectamine 2000 along with a cherry red internal control (0.5 μg) in Opti-MEM (Life Technologies) as per manufacturer’s instructions. [score:1]
[1 to 20 of 9 sentences]
10
[+] score: 40
Only one miRNA was up-regulated (mmu-miR-206-3p), while 6 out of 8 were down-regulated (i. e., mmu-miR-3107-5p, mmu-miR-1912-3p, mmu-miR-1264-5p, mmu-miR-486-3p, mmu-miR-144-5p and mmu-miR-144-3p). [score:7]
As shown in Figure 3, miRNA enrichment and pathway analysis after irradiation, highlighted only a limited number of altered functions, the most significant of which were related to Nucleotide Excision Repair (NER; Gtf2h2 and Polr2b genes which are predicted targets of mmu-miR-302b-3p and mmu-miR-144-3p, respectively) and the regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs) (Mmp2 and Igfbp2 genes are both predicted target genes of mmu-miR-486-5p). [score:6]
Similarly, for the last miRNA analyzed, i. e. miR-486 (Figure 7I), controlling the IGF signaling pathway (Figure 5), the fold change in expression was increased by irradiation, highlighting that a combination of biological functions, influenced by different miRNAs, may modify the short-term response to radiation in combination with deregulation of Shh signaling pathway. [score:4]
The Molecule Activity Predictor (MAP), based on significantly deregulated miRNAs, suggests the inhibition of senescence (blue) and a concurrent increase of cell survival and viability (light orange) and DNA damage (dark orange), mainly due to the miRNAs let-7a, mir-17, mir-21, mir-34a, mir-92, mir-133a, mir-181a and mir-486 (Figure 6). [score:4]
Due to the regulation of miR-486 by p53 and its role in cell-cycle control, it is conceivable that miR-486 acts only at short term after irradiation, because both p53 activation and inhibition of cell growth decrease out just 24 hours after irradiation. [score:4]
miRNA enrichment and pathway analysis revealed that, in the cell compartment analyzed, miR-486 directly targets components of insulin growth factor (IGF) signaling. [score:4]
Finally, Ptch1 [+/−] GCPs express higher levels of miR-486 than WT cells, irrespective of irradiation. [score:3]
Finally, miR-486 expression levels did not differ between spontaneous and radio -induced MB. [score:3]
However, after irradiation, mir-486 expression level in Ptch1 [+/−] GCPs was significantly increased compared with unirradiated cells. [score:2]
In addition, it has been reported that miR-486 is regulated by p53 demonstrating a key role of this miRNA in controlling G1/S transition following DNA damage [45]. [score:2]
According with this assumption, evaluation of miR-486 expression in tumors shows the same level in spontaneous and radio -induced MB. [score:1]
[1 to 20 of 11 sentences]
11
[+] score: 34
Several of these miRs have previously been shown to exert regulatory effects in the heart: miR-486-3p, upregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to be upregulated in the hearts of swim-trained mice and involved in the antifibrotic effects of exercise [37]; Let-7e, upregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to have an antiarrhythmic effect mediated via a downregulation of the β1 adrenergic receptor in myocardial infarction rats [38]; finally, miR-10b-5p, downregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to regulate the key cardiac transcription factor Tbx5, known to be involved with the cardiac conduction system. [score:18]
After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars). [score:7]
[17] Using the wi dely used algorithms RNA22, [18] PITA, [19] and TargetScan Mouse v7.1, [20] we identified putative recognition sites for miR-423-5p (Online Figure II) and miR-486-3p (data not shown) within the mouse HCN4 3′-UTR sequence. [score:3]
To verify these predicted binding sites and experimentally establish HCN4 as a genuine target, we fused the HCN4 3′-UTR to a luciferase reporter gene (pHCN4-3′ UTR) and determined luciferase activity in H9c2 cells cotransfected with pHCN4-3′ UTR and synthetic precursors to miR-423-5p and miR-486-3p. [score:3]
All miRs tested significantly supressed luciferase activity relative to a control (scrambled) miR, although suppression was modest on transfection with miR-1 and miR-486-3p (34%; data not shown) compared with miR-423-5p (Figure 3A). [score:2]
Lv DC Bei YH Zhou QL Sun Q Xu TZ Xiao JJ miR-486 mediates the benefits of exercise in attenuating cardiac fibrosis. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 27
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Relative to the control, the expression levels of both miR-486-5p and-3p arms were 11.6 fold higher, indicating that the majority of the cells expressed elevated miR-486 levels. [score:5]
Our finding indicating that upregulation of miR-486 is coupled to increased tissue invasiveness, as found with 22Rv1 human prostate cancer cells (Fig. 1b), supports the biological significance of the present study. [score:4]
Although this result has borderline significance (p = 0.08), it indicates that increased expression of miR-486 enhances tissue invasiveness. [score:3]
Effects of overexpression of miR-486 on proliferation and tissue invasiveness of 22Rv1 human prostate cancer cells. [score:3]
Data are expressed as percent invasiveness ± S. D. and show increased invasiveness of miR-486 -transfected cells (85% ; p = 0.08). [score:3]
0024950.g001 Figure 1 A) As indicated by, there was no significant difference between the growth of miR-486 -transfected cells and control cells over a 72-hr period. [score:1]
Invasiveness of miR-486 -transfected 22Rv1 cells. [score:1]
A) As indicated by, there was no significant difference between the growth of miR-486 -transfected cells and control cells over a 72-hr period. [score:1]
However, the miR-486 -transfected cells showed an increase of about 85% in tissue invasiveness relative to the control cells (Fig. 1B). [score:1]
The mir-486 precursor had been properly processed to the mature miR-486 form as indicated by qPCR. [score:1]
The proliferation rate of miR-486 -transfected and control sequence -transfected cells was similar as indicated by the (Fig. 1A). [score:1]
Increased levels of mature miR-486 in transfected cells. [score:1]
The precursor sequence of mir-486, shown in the miRBase, and a non-silencing negative control were subcloned into the pcDNA6.2-GW/EmGFP miR plasmid (Invitrogen). [score:1]
At 24 hours following transfection of 22Rv1 cells with pcDNA6.2-GW/EmGFP-mir486 or pcDNA6.2-GW/EmGFP-control sequence, more than 90% of the cells were found to be GFP positive. [score:1]
[1 to 20 of 14 sentences]
13
[+] score: 22
We previously identified 11 miRNAs which were upregulated or downregulated in myostatin knockout mice by microarray analysis, and validated the expression of miR-486 and miR-206 [12]. [score:10]
We showed that one of these miRNAs, miR-486, is a direct molecular target of myostatin in the regulation of skeletal muscle mass [12]. [score:5]
In addition to the Dlk1-Dio3 locus, myostatin signaling was shown to regulate the expression of miR-486 [12], miR-29b/c [29], and E3 ubiquitin ligase Atrogin-1/MAFbx [30] in skeletal muscle. [score:4]
The same trend was observed for another imprinting gene, Igf2, but not in the non-imprinting miRNA, miR-486 (Figure 5E and 5F), suggesting that the expression of imprinting genes is gradually decreased in the skeletal muscle, as mice get older. [score:3]
[1 to 20 of 4 sentences]
14
[+] score: 16
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
For example, miR-127 has been shown to participate in cancer development [85], miR-145 has been shown to control c-Myc expression through p53 [86], miR-199a regulates MET protooncogene and affects NF-KB expression [54], miR-379 affects brain neuronal development [87], [88], miR-451 affects erythroid differentiation [89], miR-126 affects angiogenic signaling and controls blood vessel development [90], miR-143 regulates ERK5 signaling and targets KRAS gene [91], miR-298 regulates CYPA3 expression [92] and miR-486 regulates kinase activity and tumor progression [93]. [score:16]
[1 to 20 of 1 sentences]
15
[+] score: 16
The activity of miR-486 results in muscle hypertrophy, since it leads to the activation of mTOR via PTEN inhibiton, and to the reduction of the ubiquitin ligase expression, which sustains atrophy in skeletal muscle tissue. [score:5]
In fact, possible targets for miR-486 are PTEN (phosphatase and tensin homolog) and FoxO1A, elements of the PI3/Akt pathway (Small et al., 2010) involved in muscle wasting and apoptosis. [score:3]
The expression profiles of miR-486 strongly support its role in muscle homeostasis, since it is decreased in denervated muscles and almost absent in Duchenne patients (Eisenberg et al., 2007). [score:3]
Highly expressed miRNAs in skeletal muscle tissue are termed myomiRs, which include miR-1, miR-133a, miR133-b, miR-206, miR-208, miR208b, miR486, and miR-499 (Van Rooij et al., 2008). [score:3]
Regulation of PI3-kinase/Akt signaling by muscle-enriched microRNA-486. [score:2]
[1 to 20 of 5 sentences]
16
[+] score: 15
Dot plots show the expression levels of miR-146a, miR-193b, miR-205, miR-215, miR-467a, miR-150, and miR-486 measured for MV, MV-free plasma, and brains from NI, NCM, and CM conditions, expressed as normalized values as compared to the expression of a panel of control miRNA in each case. [score:4]
The differential expression profiles of these selected miRNA (miR-146a, miR-150, miR-193b, miR-205, miR-215, miR-467a, and miR-486) were analyzed in mouse MV, MV-free plasma, and brain tissue by quantitative reverse transcription PCR (RT-qPCR). [score:3]
NI MV OpenArray RT-qPCR hsa-miR-328 − 2.5* ± 0.93Not tested [a] hsa-miR-335* − 3.0* ± 1.13Not tested [a] mmu-miR-16* 2.8** ± 0.65Not tested [a] mmu-miR-21* 5.0** ± 0.88Not tested [a] mmu-miR-297a* 5.8* ± 1.60Not tested [a] mmu-miR-685 3.0* ± 1.00Not tested [a] mmu-miR-1949 5.0* ± 1.69Not tested [a] hsa-miR-590-5p Unique to NINot validated [b] rno-miR-450 Unique to CMNot validated [b] mmu-miR-10b 2.7* ± 0.85Not validated [b] hsa-miR-146a 3.2** ± 0.68 7.2* ± 2.74 hsa-miR-150 1.8* ± 0.64 2.7 (ns) ± 2.26 hsa-miR-205 2.3* ± 0.75 − 0.5 (ns) ± 1.89 hsa-miR-486 2.3*** ± 0.18 4.7 (ns) ± 1. 45 mmu-miR-193b − 2.7** ± 0.62 − 7.5* ± 0 62 mmu-miR-215 2.1* ± 0.554.6 (ns) ± 99.39 [c] mmu-miR-467a − 2.0* ± 0.69 − 5.6 (ns) ± 0.96 The list of significantly differentially expressed miRNA in CM vs NI MV from the was compared with the results obtained by. [score:2]
A further four miRNA—miR-150, miR-215, miR-467a, and miR-486 showed the same directional change in abundance as in the, without reaching significance (Fig.   4). [score:2]
All the remaining miRNA (Table  1, miR-146a, miR-150, miR-193b, miR-205, miR-215, mir-467a, and miR-486) were tested on MV samples as per the and also on MV-free plasma and brain tissue from NI, NCM, and CM mice. [score:1]
The results are presented as follows: significant changes in MV – miR-146a and miR-193b, significant changes in the brain—miR-205, miR-215, and miR-467a, no significant changes—miR-150 and miR-486. [score:1]
No significant change in the abundance of miR-150, miR-205, miR-215, miR-467a, and miR-486 in MV following Plasmodium infection. [score:1]
The results of these are denoted as * = 0.05–0.01, ** = 0.01–0.0001, *** ≤ 0.0001 No significant change in the abundance of miR-150, miR-205, miR-215, miR-467a, and miR-486 in MV following Plasmodium infectionOf the seven miRNA of interest tested by RT-qPCR, miR-146a and miR-193b showed the same significant change in abundance as in the OpenArray (from Fig.   2b). [score:1]
[1 to 20 of 8 sentences]
17
[+] score: 15
For the HC group, miR-26a, miR-146a, and miR-486 presented a Glo to TI ratio above 1.5, meaning that they were abundantly expressed in Glo rather than in TI, but miR-21a and miR-10b showed a 0.99 and 1.18 ratio, respectively, meaning that they were comparatively expressed in both Glo and TI. [score:5]
Recent studies reported that miR-486 in urinary sediments derived from urinary erythrocytes, not from renal parenchymal cells, significantly increased in human patients with IgA nephropathy 23 and that miR-146a expression in the kidneys was specifically associated with inflammatory cell infiltration in CKD mice 2. In the dog kidneys, the other miRNAs rather than miR-486 and miR-146a more closely correlated with renal pathogenesis or changes in renal functions. [score:3]
For these miRNAs, although UExo-derived miR-146a/miR-26a ratio correlated with renal function parameters (Table 2), a constant tendency was not observed between the expression of miR146a and miR-486 in UExo and renal functional parameters. [score:3]
miR-3107-5p was recently updated as miR-486b-5p, presenting the same mature sequence “uccuguacugagcugccccgag” as miR-486a-5p according to the mouse database (miRBase, http://www. [score:1]
Urinary Cr was significantly and positively correlated with miR-26a, miR-486, miR-10a, miR-10b, and miR-191. [score:1]
Both TI damage score and KD score were negatively correlated with Glo levels of miR-486, miR-10a, and miR-10b. [score:1]
The levels of miR-486 in Glo and the Glo/TI ratio of miR-146a also significantly correlated with renal histopathological scores, although no significant change in both Glo and TI was detected between HC and KD dogs. [score:1]
[1 to 20 of 7 sentences]
18
[+] score: 13
Other miRNAs from this paper: hsa-mir-486-1, hsa-mir-517a, mmu-mir-486a, hsa-mir-486-2
Studies have shown that TNIP1 is a direct functional target of miR-517a/c [43], and the overexpression of miR-486 repressed the expression level of TNIP1 in vitro [44]. [score:8]
Interestingly, miR-486 is decreased in psoriatic skin [45], which strongly suggested that there may be other miRNAs contributing to the inhibition of TNIP1 translation. [score:5]
[1 to 20 of 2 sentences]
19
[+] score: 12
This mRNA is targeted by miR-9-5p [47], miR-21-5p, miR-16-5p (TargetScan), miR-183-5p [47], miR-486b-5p [82], and miR-153-3p [47]. [score:5]
From the above six miRNAs, all but miR-486b-5p were changed significantly in our study and these potentially could regulate the expression levels of FOXO1 in AM under OxS (Fig.   8). [score:4]
FOXO1 is targeted by a multitude of miRNAs that are changed in our study miR-9-5p, miR-21-5p, miR-16-5p, miR-183-5p [47], miR-486b-5p, and miR-153-3p. [score:3]
[1 to 20 of 3 sentences]
20
[+] score: 10
In these libraries, known miRNAs had a broad range of expression level; some (such as mir-486-5p and mir-3107-5p) were found to have hundreds of thousands of sequence reads, while many others had less than 20, indicating that expression varies significantly among different miRNA families. [score:5]
With more than 6000 reads, 3 miRNAs (mir-486-5p, mir-3107-5p, and mir-92a-3p) were dominantly expressed in all these 12 libraries (Additional file 1: Table S6). [score:3]
In addition to mir-486-5p and mir-3107-5p, which have more than 200000 sequence reads in all 12 libraries, mir-92a-3p was the third most abundant miRNA with sequence reads ranging from 6659 to 16734 (Additional file 1: Table S6). [score:1]
Among them, there were 52 mature miRNAs with sequence reads ≥ 400 (Additional file 1: Table S4) and 10 mature miRNAs (mir-10b-5p, mir-133a-1-3p, mir-133a-2-3p, mir-191-5p, mir-22-3p, mir-25-3p, mir-3107-5p, mir-486-5p, mir-92a-1-3p, mir-92a-2-3p) with sequence reads ≧ 4000 in at least 1 of the 12 twelve libraries (Additional file 1: Table S5). [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 10
Hitachi et [43] reported that the expression level of miR-486 in skeletal muscle was significantly increased, and showed that, miR-486, which is a positive regulator of the IGF-1/Akt pathway, is involved in myostatin signaling in myostatin knockout mice. [score:5]
We have identified several miRNAs that are up-regulated in MSTN [-/-] pigs, and these miRNAs have previously been shown to be involved in myoblast development, including the well-known miR-1, miR-206 [13, 15], and miR-486 [26] (Figure 1A). [score:5]
[1 to 20 of 2 sentences]
22
[+] score: 9
In these libraries, known miRNAs had a broad range of expression levels; some (such as miR-486-5p and miR-3107-5p) were found to have more than hundreds of thousands of sequence reads, while many others had ≤20, indicating that expression varies significantly among different miRNA families. [score:5]
With ≥5,000 reads, the following four miRNAs were dominantly expressed in all these six libraries: miR-25-3p, miR-486-5p, miR-3107-5p, and miR-92a-3p (Supplementary File 1: Table S5). [score:3]
In addition to miR-486-5p and miR-3107-5p, which have ≥200000 sequence reads in all six libraries, miR-92a-3p and miR-25-3p were the third and fourth most abundant miRNA in (F)7d (22068 and 13644 reads, resp. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 9
We evaluated the expression of PTEN and these miRs by real-time PCR, and we noticed that PTEN was lower-expressed (Fig. 1c), while miR-32-5p, miR-21-5p, miR-19a-3p, miR-92a-3p, and miR-486-5p were all highly-expressed in Bel/5-FU cells (Fig. 1d). [score:5]
Increasing evidence shows that PTEN -regulating miRs, such as miR-141-3p [10], miR-29a [11], miR-21 [12– 16], miR-19a [17], miR-92a [18], and miR-486 [19] contribute to anti-tumor treatment resistance. [score:2]
org databases) and literature review, we found that miR-32-5p, miR-19a-3p, miR-92a-3p, and miR-486-5p have complementary binding sites to the 3’-UTR of PTEN (Fig. 1b and Additional file 3). [score:1]
The relative expression of miR-32-5p, miR-21-5p, miR-19a-3p, miR-92a-3p, miR-486-5p and U6, PTEN, Twist, Snail, and GAPDH mRNA was measured with SYBR® Premix Ex Taq™ II (Perfect Real Time, Takara, Shiga, Japan) as previously described [8]. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 9
On the contrary, the relative expression of miRNA-486 was significantly up-regulated (P = 0.042) in the denervated tibialis anterior muscle tissues. [score:6]
Indeed, the relative fold values of miRNA-486 change of expression were 3.02, 5.12 and 2.55 for the 3 mice examined. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 7
Figure 1A shows that 30 miRNAs were significantly modulated by more than two-fold, within these seven miRNAs were upregulated (let-7d, life-26-3p, miR-16, miR-451, miR-486-5p, miR-518e*, miR-720) and twenty one were downregulated. [score:7]
[1 to 20 of 1 sentences]
26
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
Several microRNAs had similar expression when comparing results from the present study with those of There were nine microRNAs (bta-miR-10b, bta-miR-423-3p, bta-miR-99a-5p, bta-miR-181a, bta-miR-423-5p, bta-miR-148a, bta-miR-26a, bta-miR-192, and bta-miR-486), that were upregulated in earlier stages of life in both studies. [score:6]
Bta-miR-486 had the fewest counts during fall, 2013, and the highest in spring, 2014 (P = 0.0347), while bta-miR-122 had the lowest in summer, 2013, and the highest in spring, 2014 (P = 0.0143). [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 7
miR-181, miR-30b* and miR-874 are additional suggestive eQTL with significant genome-wide (α < 0.1) threshold after permutationSimilarly, on chromosome 8 we identified eQTL for three miRNAs (miR-486, miR487b and miR-501) in confidence interval 72–95 Mb. [score:2]
miR-181, miR-30b* and miR-874 are additional suggestive eQTL with significant genome-wide (α < 0.1) threshold after permutation Similarly, on chromosome 8 we identified eQTL for three miRNAs (miR-486, miR487b and miR-501) in confidence interval 72–95 Mb. [score:2]
We found only trans – eQTL, except for miR-486 (−log P = 4.10, rs13479880), which was mapped to the same chromosome of its transcriptional site (Chr 8, ~89 Mb). [score:1]
In line with this observation, for the eQTL mapped on chromosome 8, two miRNAs (miR-501-3p and miR-486) were clustered with the ‘brown’ module while miR-487 was assigns to the ‘red’ module but had significant module membership with the brown module as well (P = 0.004). [score:1]
Helicases like Ddx39, Ddx49, Cd97 and Upf1 were mapped within the confidence interval of miR-486, miR-487b and miR-501 on chromosome 8. Further, four helicases (Ddx50, Ascc3, Ddx21 and Dna2) were mapped within the confidence interval of the eQTL controlling miR-126. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 6
Hsa-miR-15a-5p, hsa-miR-16-5p, hsa-miR-30c, hsa-miR-451a, hsa-miR-191-5p, hsa-miR-486-5p and hsa-miR-335-3p for instance have been described to be aberrantly expressed in metastatic neuroblastoma tumors 23. [score:3]
Some of these, like hsa-miR-30c or hsa-miR-486-5p were only found differentially expressed in depleted samples, further underlining the benefit of performing 5′ tRNA halves depletion. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 6
miR-486, also expressed in normal epithelium, has been shown to be down-regulated in mammary cancer. [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
The analysis of microRNA targets of the microRNA-486 family indicated 298 potentially down-regulated mRNAs. [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 6
In addition to well-known myomiRs, recent studies have demonstrated that miR-486 [49], miR-378 [50], miR181a [80], miR-21a, miR-101a, and miR-151 [54] are also involved in regulation of myogenesis and several other ubiquitously expressed miRNAs have also been found to participate in myogenesis, including miR-26a [51], miR-27b [52, 53], and miR-29 [44]. [score:4]
A group of miRNAs, highly enriched in skeletal muscle (referred to as myomiRs), has recently been identified and includes miR-1, miR-133a, miR-133b, miR-206, miR-208, miR-208b, miR-486, and miR-499 [33– 37]. [score:1]
Six isomiRs i. e. mmu-miR-16a-2, mmu-miR-133a-1, mmu-miR-188b-2, mmu-miR-199a-2, mmu-miR-486 and mmu-miR-26b-5P were selected. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 5
Small E. M. O’Rourke J. R. Moresi V. Sutherland L. B. McAnally J. Gerard R. D. Richardson J. A. Olson E. N. Regulation of PI3-kinase/Akt signaling by muscle-enriched microRNA-486 Proc. [score:2]
The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181. [score:1]
In our sequencing libraries, five of these known myomiRs (miR-486, miR-26a, miR-27b, miR-378 and miR-181) were identified with the greatest abundance, accounting for 26% and 29% of the total normalized miRNA reads in the LPS-challenged and saline -treated groups, respectively. [score:1]
Previous studies have demonstrated that the myomiRs miR-1, miR-133a/b, miR-206, miR-486, miR-26a, miR-27b, miR-378, miR-148a and miR-181 are highly enriched in skeletal muscle and play a key role in skeletal muscle metabolism [28, 29, 30, 31]. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 5
Other miRNAs from this paper: mmu-mir-15a, mmu-mir-16-1, mmu-mir-23a, mmu-mir-486a
The induction of HbF can be obtained by using low molecular weight drugs causing the induction of the γ-globin gene (6– 8, 14– 17), artificial promoters (18, 19), decoy molecules targeting transcription factors involved in the transcriptional repression of γ-globin genes (MYB, KLF-1 and BCL-11A) (20, 21), or microRNAs targeting mRNAs coding for these repressors (data are available for microRNAs miR-15a, miR-16-1, miR-486-3p and miR-23a/27a) (22– 24). [score:5]
[1 to 20 of 1 sentences]
34
[+] score: 5
The top ten highly expressed miRNAs (ranked by the mean expression value of three tissues) are miR-199a-3p, miR-199a-5p, miR-146a-5p, miR-146b-5p, miR-125a-5p, miR-200a-3p, miR-200b-3p, miR-142a-5p, miR-486b-5p and miR-182-5p. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
The absorbance at 414 nm had a significant effect on the expression of eca-miR-25 (FDR = 4.15e-4) and eca-miR-486-5p (FDR = 0.066) that was previously reported as haemolysis dependant [27]. [score:3]
Among the 965 mature miRNAs, we observed that miR-486 was the most abundant, together with a putative novel miRNA identified in the opposite strand of miR-486, which was given here an identifier name ecaub_miR_1177. [score:1]
The four novel miRNAs identified by miRdentify partially overlapped with known miRNAs: the ecaub_novel-miR-1175 was only two nucleotides shorter than eca-mir-744, ecaub_novel-mir-1176 overlapped the position of an Ensembl predicted ENSECAG00000025869, whereas the ecaub_novel-mir-1177 was identified on the opposite strand of the eca-mir-486, and ecaub_novel-mir-1778 was located in the region of another Ensembl predicted ENSECAG00000026103. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 5
Five out of the 35 DEMs in the network have targets involved in all four of the pathophysiological processes (miR-238-3p, miR-149-5p, miR-143-3p, miR-145-5p and miR-486-5p); an additional six DEMs target genes involved in three of the four processes (miR-138-5p, miR-9-5p, miR-26a-5pmiR-185-5p, miR-200b-3p and miR-335-5p). [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 5
They found that miR-320, miR-378, miR-211, miR-200a,b and miR-184 were significantly down-regulated during both stages of hibernation compared with non-hibernating animals, whereas miR-486, miR-451, miR-144 and miR-142 were significantly overexpressed in late torpor phase [22]. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 4
044hsa-miR-18b2.20.014hsa-miR-423-5p1.70.048hsa-miR-932.10.014hsa-miR-1911.50.049hsa-miR-548b-5p2.30.015Downregulated miRNAs  hsa-miR-252.10.015hsa-miR-885-5p-4.20.00011hsa-miR-324-3p2.30.017hsa-miR-874-5.80.00018hsa-miR-3262.60.017hsa-miR-486-3p-4.60.00040hsa-miR-18a3.10.017hsa-miR-299-5p-4.20.0020hsa-miR-20b2.00.017hsa-miR-488-3.90.0063hsa-miR-1942.80. [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
miR-483-5p and miR-486-5p are down-regulated in cumulus cells of metaphase II oocytes from women with polycystic ovary syndrome. [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
To explore whether other miRNAs and genes involved in germ cell development were altered in PGCs as consequence of VCZ exposure, we examined the expression of miR-21, miR-135*, miR-381 and miR-486 miRNAs. [score:4]
[1 to 20 of 1 sentences]
41
[+] score: 4
MYB controls erythroid versus megakaryocyte lineage fate decision through the miR-486-3p -mediated downregulation of MAF. [score:4]
[1 to 20 of 1 sentences]
42
[+] score: 4
Mir-486 was also interesting as its targets showed low expression almost exclusive to microacinar and EMT tumors. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
Many miRNAs, such as miR-1, miR-133, miR-29, miR-214, miR-206, miR-486, miR-208b, and miR-499 were involved in the regulation of skeletal myogenesis by binding to its target genes 36, 37. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 4
miR-296-3p, miR-125a-5p, miR-342 and miR-486 have all been shown to be regulated by retinoic acid (Figure 2; Additional file 4). [score:2]
In particular, miR-486, miR-24, miR-182, miR-615-3p and miR-125a-5p are regulated by Tp53 (Figure 2; Additional file 4). [score:2]
[1 to 20 of 2 sentences]
45
[+] score: 4
Besides, miR-486-5p, expression of which in 231-B cells was decreased by 70% compared with that of 231-P cells, was recently reported to inhibit metastasis of lung cancer by reducing the protein level of ARHGAP5 (28). [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
miR-486 also regulates Pax7 expression and a miR-resistant form of Pax7 causes defective differentiation in myoblasts [40]. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 3
In lung cancer, multiple miRNAs, such as let-7 family, miR-200, miR-486 and miR-146a have been identified as tumor suppressors [10– 14]; on the other hand, miR-31, miR-212 and miR-196a were found to promote NSCLC carcinogenesis [15– 17]. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
In addition to the finding that miRNAs as a whole are essential to proper muscle formation, individual miRNAs have been shown to play key roles in myogenesis, including species that regulate satellite cell quiescence (miR-489, [6]), promote proliferation (miR-133, miR-27 [7, 8]), promote myoblast differentiation (miR-206, miR-1, miR-486 [9– 11]), and regulate fiber type switching (miR-499, miR-208a, miR-208b [12]). [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Notably, miR-486 levels do not change in the hippocampus after Dicer loss [8] and this miRNA was not differently expressed in TLE-HS in our study. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
In the present study, using LAC cell lines, we identified several miRNAs (miR-142-3p, miR-143-3p, miR-145-5p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p, and miR-605-5p) that are selectively packaged into EVs and released into the tumor microenvironment. [score:1]
Five of our eight EV miRNA candidates (miR-142-3p, miR-150-5p, miR-223-3p, miR-451a, miR-486-5p) were shown to be increased by hemolysis and were thus excluded from analysis. [score:1]
Four of our miRNA candidates (miR-142-3p, miR-150-5p, miR-451a, and miR-486-5p) are found within EVs of many cell types including HEK 293T cells, breast cancer cells, and oral cancer cells [21, 22]. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 3
Other miRNAs from this paper: mmu-mir-144, mmu-mir-486a, mmu-mir-495
This approach confirmed the differential expression of several miRNAs such as miR-495 and miR-486, which are involved in cancer cell growth and invasion in vitro and in vivo [30, 31]. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
As indicated in Table 2, among the top 20 miRNAs, miR-486, miR-16, miR-451 and miR-92a are mainly expressed by RBCs [9, 18] and account for 45% reads of the mapped miRNAs. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 2
We identified a second set of trans-eQTL on Chr 9 at ~107-108 Mb for miR-486 and miR-451, but the allele effects for these eQTL were not completely consistent (Additional file 1: Figure S6), thus we cannot conclude that these two trans-eQTL are one and the same. [score:1]
Allele Effects for miR-451 and miR-486 trans-eQTL on Chr 9. Figure S7. [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 2
miR-24 and miR-486 were used as negative controls. [score:1]
Our qPCR results demonstrated no change in the level of miR-24 and miR-486 in CR vs. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 2
According to a recent review of miRNA expression in schizophrenia [27], a total of 13 miRNAs that were measured in our TLDA assay have been associated with increased expression in multiple previous studies (miR-128a, miR-15a, miR-15b, miR-16, miR-17, miR-199a*, miR-20a, miR-222, miR-34a, miR-452*, miR-486, miR-487a, miR-652). [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Oh HK Genomic loss of miR-486 regulates tumor progression and the OLFM4 antiapoptotic factor in gastric cancerClin. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
Our analysis also suggests that 6 DEmiRs, miR-17-5p, miR-486b-5p, miR-19a-3p, miR-484, miR-199a-5p and miR-182-5p, are likely to be co-regulated by both Ctcf and Spi1. [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 2
In this study, we identified miR-486b, miR-3963 and miR-6412 as novel myogenic differentiation-related miRNAs, the functions of which are largely unknown. [score:1]
Additionally, miR-23a [15], miR-24 [16], miR-26 [17], miR-27a [18, 19], miR-27b [20], miR-29 [21], miR-124 [22], miR-128a [23], miR-146b [24], miR-148a [25], miR-155 [26], miR-181 [27], miR-199 [28], miR-186 [29], miR-214 [30], miR-221/222 [31], miR-351 [32], miR-486 [33], miR-489 [34], miR-499 [35] and miR-3906 [36] are reported to be involved in skeletal myogenesis. [score:1]
[1 to 20 of 2 sentences]
60
[+] score: 1
Most candidates had 5′seed sequences distinct from known miRNAs; however the following candidates, conserved with humans, were similar to those in parentheses: 5 (miR-190/190b), 19 (miR-29b-2), 92 (miR-1195), 93 (miR-134), 132 (miR-486), and 183 (miR-345-3p). [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Our previous study found that miR-196a, miR-486-5p, miR-664-star, and miR-378-star were significantly increased whereas miR-10a, miR-708, and miR-3197 were decreased in old hBM-MSCs. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
To confirm the therapeutic importance of miRNAs in silica -induced pulmonary fibrosis, our previous work have revealed that miR-486-5p and miR-489 play important anti-fibrotic roles in silica -induced pulmonary fibrosis 15, 16. miR-503, located on the chromosome Xq26.3, is an intragenic miRNA, and belongs to the miR-16 family [17]. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
However, other miRNA levels are increased or decreased in proportion to the amounts of alcohol consumed (as shown by WGCNA) or augmented in dependent mice only (e. g., miR-1955-5p and miR-486-3p in CTX). [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Plasma miR-22, miR-101b, miR-122, miR -133a, miR135a*, miR-192, miR193 and miR486 have been shown to be affected by liver damage [39]. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
# These 2 miRNAs, miR-486 and miR-3107, are recognized by the same probe. [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
miR-486 sustains NF-kappaB activity by disrupting multiple NF-kappaB -negative feedback loops. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
Ji X The anti-fibrotic effects and mechanisms of microRNA-486-5p in pulmonary fibrosisSci. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
These include miR-1937a (−3.6 fold), miR-494 (−3.39 fold), miR-29c (−3.19 fold), miR-150 (−2.95 fold), miR-486 (−2.37 fold), miR-30c (−2.35 fold) and miR-30b (−2.14 fold). [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Indeed, microRNA-1 and -133 (Elia et al. 2009; Hua et al. 2012), microRNA-125 (Ge et al. 2011), microRNA-206 (Yan et al. 2013), and microRNA-486 (Small et al. 2010) modulate IGF-1/PI3K/AKT signaling, as well as protein synthesis (Wang 2013). [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Our previous studies have confirmed that the miRNAs, miR-181a-5p, miR-146a-5p, miR-32, miR-34a and miR-486-5p, have important roles in the progression of NSCLC. [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
For normalization of sample variation, 5 ng internal control Mmu-miR-486 and external miRNAs control Cel-miR-238 were added to each plasma sample for extraction and qRT-PCR. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
For example, two well-known miRNAs, miR-133 and miR-486, modulate skeletal muscle proliferation and differentiation [19]. [score:1]
[1 to 20 of 1 sentences]