sort by

2 publications mentioning ctr-MIR171

Open access articles that are associated with the species Citrus trifoliata and mention the gene name MIR171. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR414, osa-MIR419, osa-MIR435, osa-MIR390, osa-MIR396e, osa-MIR530, osa-MIR535, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1426, osa-MIR169r, osa-MIR1436, osa-MIR1440a, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ctr-MIR156, ctr-MIR166, ctr-MIR319, ctr-MIR164, ctr-MIR167, osa-MIR395x, osa-MIR395y, osa-MIR1440b
We also found homologs of known miRNA target genes for several conserved C. trifoliata miRNAs, such as SBP for miR156, ATP synthase for miR159, ARF for miR160, NAC for miR164, HD-Zip for miR165 and miR166, Anthocyanidin synthase for miR169, GRAS for miR171, AP2 for miR172, TCP for miR319, TIR for miR393, F-box for miR394, Sulfate transporter 2.1 for miR395, IRX12 copper ion binding/oxidoreductase for miR397, ARGONAUTE 2 for miR403, Basic blue copper protein for miR408 and Zinc finger protein-related for miR414. [score:3]
Additionally, fifteen miRNA families namely miR156, miR159, miR160, miR162, miR164, miR166, miR167, miR168, miR169, miR171, miR172, miR390, miR394, miR403, and miR1446, were found to have some thousands to tens of thousands of redundancies while four families (miR395, miR396, miR397, miR414, and miR827), had more than one hundred redundancies. [score:1]
[1 to 20 of 2 sentences]
2
[+] score: 2
Other miRNAs from this paper: ctr-MIR156, ctr-MIR319, ctr-MIR164, ctr-MIR167
Pt-miRNAs Sequence in PT miRNAs in Arabidopsis or other plants Computational prediction Region of precursor Sequencing replicates 5′-RACE nt (frequency) PT Arabidopsis ptrmir156 UGACAGAAGAGAGUGAGCAC UGACAGAAGAGAGUGAGCAC UGACAGAAGAGAGUGAGCAC UA CUGACAGAAGAGAGUGAGCACACG 3 1(1/16); 10(14/16) 10(8/12);9(4/12) ptrmir164 UGGAGAAGCAGGGCACGUGCA UGGAGAAGCAGGGCACGUGCA UGGAGAAGCAGGGCACGUGCA GA UGGAGAAGCAGGGCACGUGCAUU 3 9(2/16); 10(12/16); 12(2/16) 10(13/13) ptrmir167 UGAAGCUGCCAGCAUGAUCUGA UGAAGCUGCCAGCAUGAUCUGA UGAAGCUGCCAGCAUGAUCUGA GU UGAAGCUGCCAGCAUGAUCUGAA 3 9(12/15) 9(9/12) ptr-mir171 UUGAGCCGCGUCAAUAUCUCC UUGAGCCGUGCCAAUAUCACG UUGAGCCGCGUCAAUAUCUCC UCA UUGAGCCGCGUCAAUAUCUCCUU 3 13(10/20);10(10/20) 12(1/12); 11(1/12); 10(10/12) UGAGCCGCGUCAAUAUCUCCU 3 ptrmir319 UUGGACUGAAGGGAGCUCCC UUGGACUGAAGGGAGCUCCC UUGGACUGAAGGGAGCUCCC UGC UUGGACUGAAGGGAGCUCCCAUU 3 10(15/15) 10(13/13) ptrmir482a UCUUCCCUACUCCACCCAUGCC UCUUCCCUACUCCUCCCAUUCC UCUUCCCUACUCCACCCAUG AUA UCUUCCCUACUCCACCCAUGCCAU 3 10(17/18) 8(7/8) UCUUCCCUACUCCACCCAUGCC 3 ptrmir482b UCUUCCCUAUGCCUCCCAUUCC UCUUCCCUACUCCUCCCAUUCC UCUUCCCUAUGCCUCCCAUUCC AAUU UCUUCCCUAUGCCUCCCAUUCCUAU 3 8(8/9) UCUUCCCUAUGCCUCCCAUU 3 ptrmir1446 AUCUGAACUCUCUGCUUCAA UUCUGAACUCUCUCCCUCAA AUCUGAACUCUCUGCUUCAA UGG AAUCUGAACUCUCUGCUUCAAAUU 3 10(12/16) 13(10/10) ptrmir435 UUAUCCGGAAUUGGAGUCGG UUAUCCGGUAUUGGAGUUGA UUAUCCGGAAUUGGAGUCGG GG UUAUCCGGAAUUGGAGUCGGCUG 3 The mature miRNA sequences are shaded. [score:1]
Lanes 1–9 are 3′RACE products of ptr-miR156, ptr-miR164, ptr-miR167, ptr-miR171, ptr-miR319, ptr-miR482a, ptr-miR482b, ptr-miR435, and ptr-miR1446, respectively, and lanes 10–18 are the 5′RACE products of them. [score:1]
[1 to 20 of 2 sentences]