sort by

17 publications mentioning ssc-mir-92a-1

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-92a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 41
On the other hand, comparing both infected groups, two miRNAs were up-regulated in Begonia infected group and down-regulated in NIA-3 infected group, being, consequently, DE between both infected groups: miR-92a and miR-92b-3p. [score:7]
While in the in vitro samples miR-92a was DE presenting an up-regulation in Begonia strain infection, in the in vivo samples its expression was higher in NIA-3 strain infection. [score:6]
In silico target prediction were performed for those most abundant and DE porcine miRNAs presenting differential expression between NIA-3 and Begonia infected groups: miR-92a and miR-92b-3p from the in vitro approach and miR-206, miR-133a, miR-133b and miR-378 from the in vivo approach. [score:5]
of Host miRNAs In silico target prediction were performed for those most abundant and DE porcine miRNAs presenting differential expression between NIA-3 and Begonia infected groups: miR-92a and miR-92b-3p from the in vitro approach and miR-206, miR-133a, miR-133b and miR-378 from the in vivo approach. [score:5]
In this sense, the host response generated in the Begonia in vivo infection could cause the miR-92a fall of expression. [score:3]
Another miRNA which changed its expression pattern between NIA-3 and Begonia infections was miR-92a. [score:3]
Regarding the involvement of host miRNAs in the regulatory network, miR-133a, miR-133b, miR-92a, miR-92b-3p and miR-378 were related to LLT and the regulatory genes EP0, IE180, UL41 and UL48. [score:3]
A wide range of significant pathways were associated to miR-92a putative targets, from pathways related to neuronal functions such as axon guidance, neuro active-ligand receptor activation and neurotrophin signalling pathway, to pathways related to more general cellular functions like endocytosis, RNA degradation and focal adhesion. [score:3]
As miR-92a, miR-92b-3p target genes were associated to a wide range of biological processes as well as nervous system pathways. [score:3]
miR-92a, miR-92b-3p, miR-133b, and miR-378 also interacted with LLT and with the regulatory genes IE180, UL41 and UL48. [score:2]
Thus, miR-92a, miR-92b-3p, miR-133a, miR-133b, miR-378 and miR-206 generated a total of 71 significant interactions with 37 SuHV-1 genes (Figure 2). [score:1]
[1 to 20 of 11 sentences]
2
[+] score: 38
From the 22 more expressed miRNAs (>80 reads) in spleen, 7 miRNAs (31.8%) were DE, four up-regulated in virulent ASFV infected animal (miR-92a, miR-126-5p, miR-92c and miR-30e-5p) and 3 down-regulated (miR-125b, miR-451 and miR-125a) (Table  4). [score:9]
Of the 8 differentially expressed miRNAs identified at the same time post-infection in infected animals with the virulent strain compared with animals infected with its attenuated strain, miR-126-5p, miR-92c, miR-92a, miR-30e-5p and miR-500a-5p presented up-regulation whereas miR-125b, miR-451 and miR-125a were down-regulated. [score:8]
Of these, miR-451, miR-145-5p, miR-181a and miR-122 presented up-regulation at late times post-infection while miR-92a, miR-23a, miR-92b-3p, miR-126-5p, miR-126-3p, miR-30d, miR-23b and miR-92c showed down-regulation. [score:7]
miR-92a was DE at different times in the spleens of animals infected with the virulent strain E75, with its expression being up-regulated at 3 dpi. [score:6]
For 7 miRNAs: miR-23a, miR-30e-5p, miR-92a, miR-122, miR-125b, miR-126-5p and miR-125a, significant pathways were found related to immune response such as B and T cell receptor signaling pathway, natural killer cell mediated cytotoxicity or Fc gamma R -mediated phagocytosis and with some processes related to the pathogenesis and virus-host interaction, like desencapsidation, apoptosis inhibition, autophagy or host DNA damage response. [score:3]
Ten miRNAs were selected for target prediction according to the highest representation by tissue and conditions: miR-23a, miR-30e-5p, miR-92a, miR-122, miR-125b, miR-126-5p, miR-145-5p, miR-125a, miR-451 and miR-126-3p. [score:3]
The participation of actin in the endocytosis process has been proposed as stimulator for the entry of large viruses, like vesicular stomatitis virus [46] and also for ASFV [47], therefore, we anticipate that miR-92a could be involved in the entry process of ASFV, corresponding with the peak of virus replication at 7 dpi. [score:1]
miR-92a interacts with the three genes identified as being involved in ASFV entry, EEA1, EGFR and PIKFYVE [55, 56] both in the virulent infection at 3 and 7 dpi and between attenuated and virulent at 3 dpi. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 28
We hypothesize that this could be caused by an insufficient sequencing depth in our libraries, because despite these similar miRNA expression levels observed between both phenotypes, a significant correlation was found between the expression levels of validated genes PTHLH, MMP8, PTGS2 and SCNN1G, and both ssc-miR-133a and ssc-miR-92a. [score:5]
In concordance with RNAseq predictions, ssc-miR-101, ssc-miR-133a and ssc-miR-181d were overexpressed in L samples while ssc-miR-92a was overexpressed in H samples. [score:5]
Loss and gain of function experiments showed that miR-92a inhibited angiogenesis in vitro and in vivo 59 and that deletion of miR-92a is sufficient to induce a developmental skeletal defect 55. [score:4]
Among the 10 miRNAs found differentially expressed in the RNAseq analysis (q-value < 0.05), we selected as candidates those that have been extensively reported in the literature as relevant in the regulation of reproduction-related genes in both pig and human: ssc-miR-92a, ssc-miR-101, ssc-miR-133a and ssc-miR-181d (See Table 3). [score:4]
However, significant correlations were found between the expression level of prolificacy-related miRNAs ssc-miR-92a and ssc-miR-133a and validated DEG analysed by RT-qPCR (Table 4). [score:3]
MiR-92, belongs to the miR-17 ~  92 cluster, demonstrated in recent reports to regulate cardiac development, endothelial cell proliferation and angiogenesis, which are relevant processes for embryogenesis and pregnancy itself 58. [score:3]
After this preliminary bioinformatic screening we proceeded to the experimental validation of the expression level of 4 of these 10 miRNAs, considering their role in reproductive-related pathways: ssc-miR-92a, ssc-miR-101, ssc-miR-133a and ssc-miR-181d. [score:3]
Again, the observed fold changes were similar in both analysis: ssc-miR-92a (RNAseq FC = 1.26, RT-qPCR FC = 1.09), ssc-miR-101 (RNAseq FC = 1.20, RT-qPCR FC = 0.94), ssc-miR-181d-5p (RNAseq FC = 1.16, RT-qPCR FC = 0.95). [score:1]
[1 to 20 of 8 sentences]
4
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 9
According to sequence count, nine miRNAs highly expressed (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Ssc-miR-532-5p, Ssc-miR-92a, Ssc-miR-26a and Bta-miR-193b, n>100) and four miRNAs lowly expressed (Ssc-miR-423-5p, Ssc-miR-29c, Ssc-miR-486 and Ssc-let-7f, n<100) in the kidney miRNAome were selected to measure their expression levels by RT-qPCR. [score:5]
Ssc-miR-99a, Bta-miR-193b and Ssc-miR-423-5p were selected to be up regulated in EU, Hsa-miR-200b-3p, Ssc-miR-532-5p and Ssc-let-7f to be up regulated in AS and, Hsa-miR-200c-3p, Ssc-miR-92a, Ssc-miR-26a, Ssc-miR-486 and Ssc-miR-29c to be up regulated in EA. [score:4]
[1 to 20 of 2 sentences]
6
[+] score: 9
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Furthermore, Qiang et al. (2017b) found three miRNAs (miR-310, miR-92, and miR-127) that were upregulated and four (miR-92d, miR-375, miR-146, and miR-694) that were downregulated by comparing a control group of Nile tilapia with a group infected with Streptococcus iniae. [score:7]
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
[1 to 20 of 2 sentences]
7
[+] score: 9
ADIPOR2 is targeted by the downregulated miRNAs miR-181d, miR-92a, miR-204 and miR-196b-5p. [score:6]
MiR-92a is generally downregulated in animal mo dels of diabetes [67]. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 8
Five upregulated (miR-146a-5p, miR-146b, miR-365-3p, miR-92a, and miR-181c) and five downregulated (miR-30b-3p, miR-214, miR-140-3p, miR-664-3p, and miR-1307) miRNAs from the microarray were selected randomly to conduct real-time PCR. [score:7]
Among them, five miRNAs (miR-365-3p, miR-378, miR-30c-5p, miR-181a, and miR-92a) had two copies in the genome, while P-m0299-5p did not map to any chromosome in the database available (supplemental Table S3). [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 7
For example, gga-miR-18, gga-miR-193a, gga-miR-193b, gga-miR-30b, gga-miR-146a, gga-miR-24, gga-miR-92, gga-miR-7b, gga-miR-7-1, and gga-miR-7-2 are up-regulated after avian influenza virus infection in previous studies whereas in our results these miRNAs are down-regulated on PID 4 33. [score:7]
[1 to 20 of 1 sentences]
10
[+] score: 5
However, we did not detect differential expression of other previously identified miRNAs (miR-223, miR-150, miR-92a), although miR-10b, miR-20a, miR-30a-5p, miR-34a, miR-17—5p, miR-16, miR-146b, and miR-155-5p expression was significantly different. [score:5]
[1 to 20 of 1 sentences]
11
[+] score: 5
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
The miR-19 level remained unchanged after treatment with the FASN inhibitor, whereas the levels of both miR-92 and miR-let7a decreased significantly (Fig 7F). [score:3]
Both miR-92 and miR-let7a show decreased expression in blastocysts from male factor infertility or polycystic ovaries compared with blastocysts obtained from fertile women[44]. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 4
In mammalian primed pluripotent stem cells, some miRNAs including miR-20, miR-92, and miR-302 regulate the apoptotic threshold and survival through targeting the pro-apoptotic protein BIM [63]. [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 3
The selected miRNAs comprised four differentially expressed miRNAs (ssc-miR-19a, ssc-miR-28–3p, ssc-miR-92a and ssc-miR195) and four novel miRNAs (chr13–4473, chr6–12459, GL892871–2–16764 and chr9–15250). [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
It contains six mature miRNAs: ssc-miR-17, ssc-miR-18a, ssc-miR-19a, ssc-miR-20, ssc-miR-19b-1 and ssc-miR-92a-1; however, only ssc-miR-17, ssc-miR-18a and ssc-miR-19a were expressed in castrated male pigs (Additional file 1: Table S5). [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Four miRNAs (miR-221/222 cluster, miR-132 and miR-92a) are represented for category C. The miRNAs in category D were highly expressed on day 50 of pregnancy. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 2
Moreover, miR-92a, one component of the miR-17-92 cluster important for the function of the immune system, could be regulated by lincRNA 841 (ENSSSCT00000035481, Table S8). [score:2]
[1 to 20 of 1 sentences]