sort by

33 publications mentioning ssc-mir-181a-2

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-181a-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 277
To further verify TNF-α as the target of miR-181a, we chose the TNF-α high expressing Hela cell line to detect whether overexpression of miR-181a could suppress the endogenous expression of TNF-α. [score:11]
The miR-181a mimic suppressed the protein level of TNF-α as expected, while the inhibitor had the reverse effect (Figure 2), indicating that miR-181a indeedly targets TNF-α and regulates its endogenous expression in human cells. [score:10]
Similarly, the miR181a inhibitor rescued the increased lipogenesis by addition of siRNA-TNF-alpha, but the inhibitor had no statistical effect on the lipogenesis (Data not shown), There may be a risk of off-target effects because the inhibitor can sequester the miRNA without causing degradation [35], which was described by previous studies [36, 37]. [score:9]
In addition, our results showed that inhibition of miR-181a decreased PDE3B mRNA expression by increasing TNF-α expression, which is in line with a former report that TNF-α promotes perilipin phosphorylation by decreasing the expression of PDE3B, resulting in accelerating TG hydrolysis [48]. [score:9]
Since we demonstrated miR-181a as a new regulator of TNF-α in porcine adipocytes, suppression of miR-181a expresssion may lead to inhibition of adipocyte differentiation. [score:8]
In this study, we demonstrated the ability miR-181a to inhibit TNF-α expression by targeting the 3’ UTR of its mRNA, thus affecting adipogenesis. [score:7]
We thus demonstrated that miR-181a promoted adipogenesis by targeting TNF-α and consequently altering the expression of genes regulated by TNF-α. [score:6]
After 8 days, formation of lipid droplets was observed by staining with Oil Red O. The miR-181a mimic obviously increased lipid droplets in porcine adipocytes (Figure 5A, 5C), same with the effects of TNF-α siRNA and TNF-α inhibitor (Figure 5B, 5C) and this regulation was rescued by the miR-181a inhibitor (Figure 5A) and TNF-α treatment (Figure 5B). [score:6]
As the GLUT4 promoter includes response elements for PPARγ and is regulated by PPARγ [46], it is likely that miR-181 increased the expression of GLUT4 via a TNF-α targeting and PPARγ dependent mechanism. [score:6]
Nevertheless, LPL is also regulated by PPARγ, and therefore the influence of miR-181 on LPL expression by repressing TNF-α may be mediated primarily through elevation of PPARγ expression [47]. [score:6]
the control (P < 0.01), n = 6. To ascertain whether miR-181a has a direct effect on porcine adipocyte differentiation, the miR-181a mimic, inhibitor or NC was transfected into pre-adipocytes, taking TNF-α siRNA /inhibitor and TNF-α as the reference effects, and then stimulated to differentiate. [score:6]
Since PPARγ mRNA dramatically increased and its protein level also increased after miR-181a transfection, it is conceivable that the observed changes in expression of genes such as GLUT4 may be, at least partly, due to alteration of PPARγ expression. [score:5]
0071568.g006 Figure 6Fat metabolism related gene expression after transfection with miR-181a mimic and inhibitor. [score:5]
After transfection of protected miR-181a mimic or inhibitor, pre-adipocytes were stimulated to differentiate, taking TNF-α siRNA, TNF-α inhibitor and TNF-α as the reference or cotransfected controls. [score:5]
Fat metabolism related gene expression after transfection with miR-181a mimic and inhibitor. [score:5]
ATGL, a rate-limiting enzyme that mediates basal lipolysis, is also negatively regulated by TNF-α (44), and its mRNA level was shown in our study to be upregulated by miR-181a. [score:5]
To investigate whether miR-181a (Figure 1A) has an effect on adipogenesis or adipocyte development, target genes were predicted, and miR-181a was found to directly target TNF-α through its 3’-UTR sequence. [score:5]
Although several targets of miR-181a have been verified, such as the homeobox protein Hox-A11, a repressor of muscle differentiation [39], p300/CBP -associated factor (PCAF) [40] and GRP78 [41], targets related to adipocyte differentiation have not yet been reported. [score:5]
In this study, miR-181a was shown to increase LPL mRNA expression by inhibiting TNF-α. [score:5]
Though the miR181a inhibitor rescued the increased lipogenesis by addition of miR181a mimics, the inhibitor did not cause significant change of lipogenesis relative to control group. [score:5]
Thus it is reasonable that miR-181a elevated HSL mRNA expression by inhibiting TNF-α in our study. [score:5]
Similar to the results of, the miR-181a mimic, TNF-α siRNA and TNF-α inhibitor could significantly increase the amount of TG (Figure 5E, 5F; * P < 0.05, ** P < 0.01), and this effect was also rescued by transfection of the inhibitor and also TNF-α treatment (Figure 5E). [score:5]
Expression levels of the fatty synthesis related genes (PDE3B, LPL, PPARγ, GLUT1, GLUT4, adiponectin and FASN) were dramatically increased in cells after transfection of the miR-181a mimic relative to control, while they decreased significantly after transfection of the inhibitor relative to the control (Figure 6A, * P < 0.05, ** P < 0.01). [score:5]
Cells transfected with the mimic were harvested in 2-day intervals, while the inhibitor and NC groups were collected on day 8. Although the level of miR-181a gradually decreased during differentiation (Figure 4B), it was still dramatically higher than that of the NC group (P < 0.01), and the cells transfected with the inhibitor showed a lower miR-181a level than that of the NC group (P < 0.01, Figure 4C). [score:5]
By using Targetscan and miRanda software, TNF-α was predicted to be a potential target for miR-181a in pigs and humans. [score:5]
In our former study, miR-181a was shown to be significantly up-regulated in fat-rich pigs (Lantang, a local breed in China), relative to those with relatively less fat (Landrace), either in adipose tissue (Figure S1) or skeletal muscle. [score:4]
MiR-181a directly regulates TNF-α expression via 3’ UTR sites. [score:4]
0071568.g001 Figure 1 MiR-181a directly regulates TNF-α expression via 3’ UTR sites. [score:4]
In summary, miR-181a regulates adipogenesis by affecting expression of TNF-α, as well as genes involved in adipogenesis. [score:4]
Here we showed forced expression of miR-181a via transfection of its mimic in cultured pocine primary adipocytes resulted in increased lipid droplets and TG levels. [score:3]
The combined results above strongly suggested that miR181a possibally regualtes porcine lipogenesis by targeting TNF-α. [score:3]
By on day 8, the miR-181a mimic decreased while the miR-181a inhibitor promoted TNF-α protein levels (Figure 5D). [score:3]
The present study is the first to indicate that miR-181a promotes adipogenesis via targeting TNF-α. [score:3]
Transfection of miR-181a alters expression of fat metabolism related genes. [score:3]
Figure S1 Expression of miR-181a in different breed of pigs. [score:3]
The expression of miR-181a showed a trend similar to that of TNF-α, indicating that it may vary according to changes in TNF-α. [score:3]
TGAATGT was the predicted target site of miR-181a. [score:3]
To detect alterations in expression of fat metabolism related genes after miR-181a transfection, pre-adipocytes were prepared as described above and stimulated to differentiate for 8 days. [score:3]
Moreover, pre-adipocytes transfected with TNF-α siRNA or deal with TNF-α inhibitor showed the similar result of miR-181a transfection, increasing lipid droplets and TG levels (Figure 5B, 5E, 5C, 5F). [score:3]
For the first time we demonstrated that miR-181a targeted the TNF-α genes in association with porcine adipogensis. [score:3]
Cells were seeded in 6-well plates the day before transfection and transfected with miR-181a mimic/inhibitor (100 pM) using Lipofectamine 2000, and the scrambled sequence was used as a negative control (NC group). [score:3]
These results provide strong evidence that miR-181a inhibits TNF-α both in human and porcine cells. [score:3]
Thus, TNF-α was initially confirmed as the target of miR-181a. [score:3]
MiRs, such as miR-19a and miR-181 [23], have been shown to negatively regulate human TNF-α, but the regulation of TNF-α by miRs in adipocytes is still unclear. [score:3]
In both Hela cells and primary porcine adipocytes tested in our study, the miR-181a mimic decreased the TNF-α protein level, which was rescued by the miR-181a inhibitor. [score:3]
Therefore, miR-181a may be a new biomarker or new potent therapeutic target for obesity. [score:3]
By qRT-PCR analysis, this study showed that miR-181a increased the expression of those genes listed above (Figure 6A), potentially by reducing TNF-α levels. [score:3]
Interestingly, mRNA levels of the lipolysis associated genes, HSL and ATGL, also increased after miR-181a transfection, and decreased after inhibitor transfection (Figure 6B, * P < 0.05, ** P < 0.01). [score:3]
org), human TNF-α was predicted to be the target of miR-181a. [score:3]
control (P < 0.01), while transfection of the miR-181a inhibitor resulted in a significantly lower miR-181a level vs. [score:3]
Interestingly, (B) mRNA levels of HSL and ATGL increased after transfection with miR-181a and decreased after transfection with the inhibitor (* P < 0.05, ** P < 0.01, n = 6). [score:3]
of our bioinformatic analysis and luciferase reporter assay showed that miR-181a also functions by targeting the 3’ UTR of TNF-α mRNA with its seed region (Figure 1C). [score:2]
This study demonstrates that miR-181a is a novel regulator of TNF-α in porcine adipocytes. [score:2]
Seven nucleotides of TNF-α 3’ UTR (underlined) were replaced with GACCGGT using site-directed mutagenesis in order to disrupt the binding with miR-181a seed regions. [score:2]
Target verification of miR-181a against 3’ UTR of TNF-α mRNA using a luciferase report assay. [score:2]
The results led to a hypothesis that miR-181a might play an important role in adipogenesis or adipocyte development. [score:2]
MiR-181a Suppresses TNF-α Protein Levels in Hela Cells. [score:2]
Forty eight hours after transfection, the luciferase activity of the miR-181a group was significantly lower than that of the NC group (P < 0,05), and the reduction was rescued in the mutation group (Figure 1C). [score:2]
MiR-181a mimic, inhibitor or NC was transfected into Hela cells and harvested 48 h after transfection. [score:2]
MiR-181a mimic, inhibitor or NC was transfected into pre-adipocytes, which were then induced to differentiate into mature adipocytes for 8 days (Figure 4A). [score:2]
The full-length 3’ UTR of TNF-α mRNA was inserted downstream of the luciferase gene in the pGL3 reporter plasmid, and the seed sequence was also mutated to disrupt miR-181a binding (Figure 1B). [score:1]
Durability of miR-181a mimic in transfected porcine adipocytes. [score:1]
TNF-α mRNA has one putative binding site for miR-181a on the 3’ UTR. [score:1]
the control (P < 0.01), n = 6. The miR-181a mimic was transfected using Lipofectmine 2000, and endogenous miR-181a and mimics were quantified using qRT-PCR (n = 6). [score:1]
Sequence of miR-181a (www. [score:1]
More interestingly, increased lipogenesis and TG content by miR-181a mimic dramatically diminished by TNF-α addition (Figure 5C, 5F). [score:1]
0071568.g002 Figure 2 To determine the variations in miR-181a and TNF-α during the process of porcine adipogenesis, pre-adipocytes were obtained from a 7-day-old piglet and stimulated into mature adipocytes for about eight days. [score:1]
In order to ensure effectiveness of the miR-181a mimic throughout the differentiation process, we verified its persistence after transfection. [score:1]
Level of miR-181a in porcine adipocytes after transfection of its mimic. [score:1]
Western blotting showed that the miR-181a increased the protein levels of PPARγ (Figure 6C). [score:1]
Moreover, TNF-α neutralized the effect of lipogenesis caused by miR181a mimics (Figure 5C, 5F). [score:1]
These results suggest that use of the miR-181a mimic is feasible and suitable for further study. [score:1]
Changes in miR-181a levels modulate adipocyte differentiation. [score:1]
Cells were seeded in a 24-well plate one day before transfection with pGL3-TNF-α-UTR / pGL3-TNF-α-UTR-muta (500 ng), pRL-TK (Renilla luciferase normalization control, 50 ng, Promega) and miR-181a mimic (75 pM, GenePharma, Shanghai, China) using Lipofectamine 2000 (and (Invitrogen Co. [score:1]
We measured the time -dependent decline in the expression levels of miR-181a (Figure 3D) and TNF-α (Figure 3E). [score:1]
The miR-181a mimic was transfected using Lipofectmine 2000, and endogenous miR-181a and mimics were quantified using qRT-PCR (n = 6). [score:1]
miR181a mimics and TNF-α performance. [score:1]
The wild-type (pGL3-TNF-α-UTR) or mutated (pGL3- TNF-α-UTR-muta) plasmid was co -transfected with the miR-181a mimic into CHO cells, together with the Renilla control pRL-TK for normalization. [score:1]
0071568.g004 Figure 4Level of miR-181a in porcine adipocytes after transfection of its mimic. [score:1]
Pre-adipocytes were added miR181a mimics (100pM), TNF-α (Pepro Tech) and miR181a mimics + TNF-α, respectively, then induced to differentiate. [score:1]
MiR-181a regulates adipocyte differentiation. [score:1]
0071568.g005 Figure 5Changes in miR-181a levels modulate adipocyte differentiation. [score:1]
The reaction was carried out in a 96-well optical plate at 95°C for 1 min, followed by 35 cycles of 95°C for 15 s, 56 °C for 15 s and 72°C for 25 s. The cycle threshold (Ct) was recorded, and the amount of miR-181a relative to that of U6 RNA was calculated using the expression 2 [-(CtmiRNA2CtU6RNA)]. [score:1]
[1 to 20 of 83 sentences]
2
[+] score: 62
Coincidentally our data showed that the expression levels of miR-181a and miR-181c were down-regulated between gestational days 15 and 26. [score:6]
MiR-181a and miR-181c were down-regulated between gestational days 15 and 26, suggesting that they may be involved in regulation of embryo implantation. [score:5]
Three mostly well-studied genes associated with embryo implantation in pigs, namely SPP1, ITGB3 and ESR1, were the predicted targets of miR-181a and miR-181c by using three available target prediction tools. [score:5]
The miR-181a has been demonstrated to be a target of SPP1 gene to regulate metastatic function in hepatocellular cancer cell lines [32]. [score:4]
We also found that ITGB3 was putative target of miR-181a by luciferase reporter system, suggesting that the miR-181a could be the regulator for the stable adhesion between the maternal-fetal interface during pregnancy. [score:4]
Therefore, these results suggested that the miR-181a and miR-181c may target SPP1 gene in porcine endometrium to regulate embryo implantation and epitheliochorial placentation. [score:4]
Some predicted targets were the well-studied genes known to regulate embryo implantation and placentation in pigs, such as miR-181a/c- SPP1, miR-181a/c- ITGB3, miR-181c- ESR1, miR-17- STC1 and miR-31- FGF7. [score:4]
Thus, the SPP1 protein level is correlated inversely with the expression levels of miR-181a and miR-181c in porcine endometrium. [score:3]
SPP1 and ITGB3, which were the putative targets of miR-181a and miR-181c, are components of focal adhesion signal pathway. [score:3]
These results indicated that SPP1, ITGB3 and ESR1 were putative targets of miR-181a and miR-181c in the pig. [score:3]
The miR-181a and miR-181c may regulate embryo implantation and placentation by regulating the focal adhesion signaling pathway. [score:3]
To validate that SPP1, ITGB3 and ESR1 were putative targets of miR-181a or miR-181c in the pig, the 3′UTR of porcine SPP1, ITGB3 and ESR1 containing the miR-181 binding sequences were cloned into the psi-CHECK™-2 dual luciferase reporter plasmid, respectively. [score:3]
Furthermore, we found some miRNAs targeted the well-studied genes which are critical for embryo implantation in pigs, such as miR-181a/c- SPP1, miR-181a/c- ITGB3, miR-181c- ESR1, miR-17- STC1, and miR-31- FGF7. [score:3]
The result of luciferase assay for SPP1, ITGB3 and ESR1 targeting by miR-181a and miR-181c. [score:2]
The miR-181a/b/c/d, belong to the miR-181 family, were also found in category A. The miRNAs in category B were expressed at higher levels on day 26 of gestation compared to those on days 15 and 50 of gestation. [score:2]
0087867.g006 Figure 6The result of luciferase assay for SPP1, ITGB3 and ESR1 targeting by miR-181a and miR-181c. [score:2]
Validation of the Binding Sites of miR-181a and miR-181c Exist in 3′UTR of Three Genes. [score:1]
The reported plasmids along with miR-181a or miR-181c mimic were co -transfected into PK-15 cells. [score:1]
In addition, we identified that miR-181a and miR-181c can specifically bind to the 3′UTR of SPP1 gene by luciferase reporter system. [score:1]
The miRNA mimic sequences: ssc-miR-181a (5′-AACAUUCAACCUGUCGGUGAGU-3′); ssc-miR-181c (5′-AACAUUCAACGCUGUCGGUGAGUU-3′). [score:1]
The 3′UTR of SPP1, ITGB3 and ESR1 containing the miR-181a and miR-181c binding sequence was cloned into the psiCHECK™-2 dual luciferase reporter plasmid (Promega, Fitchburg, Wisconsin, United States). [score:1]
At the following day, 200ng of reporter plasmid along with 50nM of miR-181a or miR-181c mimic were co -transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, California, United States). [score:1]
[1 to 20 of 22 sentences]
3
[+] score: 29
This study used high-throughput sequencing to compare miRNA expression in pigs susceptible and resistant to E. coli F18 infection and identified 12 miRNAs with differential expression, including 11 upregulated in susceptible animals, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one down-regulated, ssc-miR-152. [score:11]
Neilon et al. reported that miR-181a is highly expressed during T lymphocyte maturation and that high levels of miR-181a expression improve B lymphocyte differentiation in mice [21]– [23]. [score:5]
These included 11 with increased miRNA expression in E. coli F18-sensitive pigs, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one with reduced miRNA expression, ssc-miR-152. [score:5]
In addition, miR-1 and miR-133 had highest levels of expression in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach. [score:3]
Further, Li et al. observed that miR-181a expression is associated with T lymphocyte antigen sensitivity and TCR signaling. [score:3]
As no commercial TaqMan miRNA assay kit is available for ssc-miR-30e, ssc-miR-148b, and ssc-miR-181a, we conducted qRT-PCR validation of the remaining nine target miRNAs between E coli F18-sensitive and -resistant groups with an increased sample size. [score:2]
[1 to 20 of 6 sentences]
4
[+] score: 21
Naguibneva et al. reported that miR-181 alleviated the repression of MyoD by downregulating Hox-A11, which represses the expression of MyoD, which, in turn, triggered the expression of muscle markers [5]. [score:8]
Ssc-miR-10b was expressed in the kidney; ssc-miR-181a was expressed in the spleen, kidney, small intestine and colon; and ssc-miR-127 was also expressed in the spleen. [score:7]
Moreover, other miRNAs were also expressed abundantly in skeletal muscles, including ssc-let-7a, ssc-let-7c, ssc-let-7f, ssc-miR-143-3p, ssc-miR-10b, ssc-miR-148a, ssc-miR-127, ssc-miR-30d, ssc-miR-30a-5p, and ssc-miR-181a. [score:3]
Other miRNAs, such as ssc-miR-10b, ssc-miR-181a, ssc-miR-30d and ssc-miR-127, were also expressed at a high level in skeletal muscles, but they were not myomiRs. [score:3]
[1 to 20 of 4 sentences]
5
[+] score: 20
As regards to miR181, over -expression of this molecule has been recently identified in minimally PRRSV-permissive cells or tissues, and this molecule is able to inhibit PRRSV replication by both mechanisms: binding to a conserved region in the downstream of open reading frame 4 [53] and downregulating the PRRSV receptor CD163 in blood monocytes and porcine alveolar macrophages [54]. [score:8]
Curiously, HR vaccinated animals presented a down-regulation of a member of the tumor necrosis factor superfamily, TNFSF15, and miR181 transcripts. [score:4]
Also transcripts encoding for the tumor necrosis factor (TNF) superfamily member 15 (TNFSF15) (−2.2 fold, P < 7.9E-05) and miR181 (−2.4 fold, P < 2.1E-04) appeared specifically down-regulated in a statistical significant manner. [score:4]
The fact that TNFSF15 and miR181 were found down-regulated in HR vaccinated pigs is noteworthy and warrant further studies. [score:4]
[1 to 20 of 4 sentences]
6
[+] score: 15
In SLN, from the 25 miRNAs more expressed (>80), six miRNAs (24%) were DE, two up-regulated at 7 dpi when compared with 3 dpi (miR-181a and miR-145-5p) and four down-regulated (Table  3). [score:8]
Of these, miR-451, miR-145-5p, miR-181a and miR-122 presented up-regulation at late times post-infection while miR-92a, miR-23a, miR-92b-3p, miR-126-5p, miR-126-3p, miR-30d, miR-23b and miR-92c showed down-regulation. [score:7]
[1 to 20 of 2 sentences]
7
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Naeem et al. (2012) demonstrated a differential regulation of four miRNAs (Bta-miR-181a, miR-16, miR-31, and miR223) in bovine mammary tissue infected with Streptococcus uberis as compared to healthy tissue while Hou et al. (2012) showed that bta-miR-296, miR-2430, and miR-671 were up-regulated and miR-2318 was down-regulated in mammary tissues of cows with mastitis. [score:7]
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
[1 to 20 of 2 sentences]
8
[+] score: 11
Among them, let-7 g, miR-17-5p, miR-17-3p, miR-20a, miR-181a, miR-16, miR-146b, miR-10b, and miR-155-5p were upregulated; let-7c, miR-122, miR-18a, miR-19a, miR-19b, miR-196b, miR-21, and miR-9 were downregulated. [score:7]
We detected the expression of miR-10b, miR-20a, miR-19b, miR-181a, miR-146b, miR-18a, and other previously identified immune-related miRNAs. [score:3]
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 11
In our previous study, we discovered that miR-181a targets TNF-α, and suppression of miR-181a decreased the expression of fat synthesis -associated genes phosphodiesterase 3B, LPL (50), PPARγ, glucose transporter 1 (GLUT1), GLUT4, adiponectin, and FASN, as well as key lipolytic genes hormone-sensitive lipase and ATGL (51). [score:7]
Li H., Chen X., Guan L., Qi Q., Shu G., Jiang Q., Yuan L., Xi Q., and Zhang Y. 2013 MiRNA-181a regulates adipogenesis by targeting tumor necrosis factor-alpha (TNF-alpha) in the porcine mo del. [score:3]
Among them, five miRNAs (miR-365-3p, miR-378, miR-30c-5p, miR-181a, and miR-92a) had two copies in the genome, while P-m0299-5p did not map to any chromosome in the database available (supplemental Table S3). [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 10
RNA-Seq revealed only a limited number of miRNA genes upregulated during ASFV infection, including miR-122, miR-138, miR-181A, miR-199A-2, and miR-1296 (Tables  2 and 3, Supplementary Table  S6). [score:4]
Several miRNAs were upregulated during OURT infection, including miR-328, miR-181, miR-1296 and miR-199 (Supplementary Table  S6). [score:4]
Other miRNAs, such as miR-181A, are essential for NK cell ontogenesis and T lymphocyte development [31]. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
12
[+] score: 9
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
They recorded changes in the expression levels of eight miRNAs (miR-1a, miR-181a, miR-133a, miR-214, miR-133b, miR-206, miR-146, and miR-26a) shown to be involved in a strong resumption of myogenesis (Zhu et al., 2014). [score:3]
Skaftnesmo et al. (2017) explored which miRNAs regulate mRNAs during initiation of puberty, and several regulated miRNAs in the pubertal stage had earlier been associated (miR-20a, miR-25, miR-181a, miR-202, let7c/d/a, miR-125b, miR-222a/b, miR-190a) or have now been found connected (miR-2188, miR-144, miR-731, miR-8157) to the initiation of puberty. [score:3]
Sea louse Caligus rogercresseyi, which affects Chilean aquaculture, were studied during infestation in Atlantic salmon and the most abundant families were mir-10, mir-21, mir-30, mir-181, and let7 in skin, head and kidney (Valenzuela-Muñoz et al., 2017). [score:1]
In addition, Nile tilapia testes and ovaries displayed miR-181a, miR-181a-5p, miR-143, and miR-143-3p as the most abundant miRNAs. [score:1]
The miRNA families miR-181, miR-143, and miR-21 were the most abundant in control groups, while miR-21, miR-181, and miR-30 were the most abundant in animals infected with P. salmonis (Valenzuela-Miranda et al., 2017). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 9
In total, the QPCR results have consisted with RNA-Seq results, three TDETGs (COL6A2, ITGB1 and CD34) and four DE miRNAs (miR-10b, miR-148a-3p, miR-181d-5p, miR-181a) were down-regulated; four TDETGs (SPATA24, KHDBPS3, TSGA10, GGNBP) and one DE miRNA (miR-133a-3p) were up-regulated by two methods. [score:7]
Nine TDETGs (CCNI, SPATA24, NEURL, KHDBPS3, TSGA10, GGNBP2, COL6A2, ITGB1 and CD34) and eight DE miRNAs (miR-301, miR-194b-5p, miR-10b, miR-148a-3p, miR-181d-5p, miR-181a, miR-133a-3p and miR-145-5p) from Table 3 were confirmed via real-time RT-PCR to be involved in spermatogenesis and testicular development. [score:2]
[1 to 20 of 2 sentences]
14
[+] score: 9
The microRNA miR-181 can target the homeobox protein Hox-A11 in early stage of myoblast differentiation [47]. [score:3]
Interestingly, Among them, miR-133, miR-1, miR-206 and miR-148a were highly abundant in MS pigs, while let-7 family, miR-214 and miR-181 were highly expressed in LW. [score:3]
Some myogenesis related miRNAs (miR-133, miR-1, miR-206 and miR-148a) are highly abundant in MS pigs, while other miRNAs (let-7 family, miR-214, miR-181) highly expressed in LW. [score:3]
[1 to 20 of 3 sentences]
15
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Our study revealed miR-181 and miR-142-3p with relatively high expression in thymus (Figure 2C), and miR18a and miR-20a appeared to be weakly expressed in thymus (Figure 2D). [score:5]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 8
Ssc-miR-21, ssc-miR-30d, ssc-miR-181, ssc-miR-199*, and ssc-miR-378 were all expressed at higher levels at the prenatal compared with the neonatal stage, and their distinct expression patterns during muscle development clearly reflected the relationship between miRNA and myogenesis. [score:5]
Nine differentially expressed miRNAs (ssc-miR-7a, ssc-miR-10b, ssc-miR-21, ssc-miR-30d, ssc-miR-127, ssc-miR-148a, ssc-miR-181, ssc-miR-199*, and ssc-miR-378) were chosen for the validation of the Solexa sequencing data via RT-qPCR. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 7
For example, miR-29, miR-181 and miR-148a can promote myoblast differentiation by inhibiting the expression of downstream target genes Akt3, Hox-A1 and ROCK1 at protein levels [10– 12]. [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 6
The mimics and inhibitors of miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365 (shown in Table S1) were obtained from GenePharma (Shanghai, China). [score:3]
To screen the potential miRNAs which can reduce PRRSV replication, the mimics or inhibitors of 10 miRNAs (Table S1), including miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365, were chosen and synthetized. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 6
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-379, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
For example, miR-273 and the lys-6 miRNA have been shown to be involved in the development of the nervous system in nematode worm [3]; miR-430 was reported to regulate the brain development of zebrafish [4]; miR-181 controlled the differentiation of mammalian blood cell to B cells [5]; miR-375 regulated mammalian islet cell growth and insulin secretion [6]; miR-143 played a role in adipocyte differentiation [7]; miR-196 was found to be involved in the formation of mammalian limbs [8]; and miR-1 was implicated in cardiac development [9]. [score:6]
[1 to 20 of 1 sentences]
20
[+] score: 6
This reduction was attributed to targeting of PRRSV RNA via a miR-181 seed match located downstream of ORF4 [6]. [score:3]
It was suggested that this reduction is likely due to a miR-181 seed match downstream of ORF4. [score:1]
For example, introduction of miR-181 mimics into PAMs also reduced PRRSV replication in vitro [6]. [score:1]
of miR-181 mimics into PAMs greatly reduced PRRSV replication in vitro. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 5
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
[1 to 20 of 1 sentences]
22
[+] score: 5
miR-181 inhibits PRRSV replication by targeting both viral genomic RNA and the receptor CD163 [14, 15]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 4
Furthermore, miR-181 was found to be involved in the process of mammalian skeletal-muscle differentiation, by targeting the homeobox protein Hox-A11 during mammalian myoblast differentiation [22]. [score:3]
These include miR-214, miR-140, miR-150, miR-10, as well as miR-181. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 3
The expression levels of 17 immune-related miRNAs, including miR-10b, miR-20a, miR-19b, miR-181a, miR-146b, and miR-18a were found to be significantly altered in PK-15 cells during PPV infection. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
Previous studies have demonstrated that the myomiRs miR-1, miR-133a/b, miR-206, miR-486, miR-26a, miR-27b, miR-378, miR-148a and miR-181 are highly enriched in skeletal muscle and play a key role in skeletal muscle metabolism [28, 29, 30, 31]. [score:1]
The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181. [score:1]
In our sequencing libraries, five of these known myomiRs (miR-486, miR-26a, miR-27b, miR-378 and miR-181) were identified with the greatest abundance, accounting for 26% and 29% of the total normalized miRNA reads in the LPS-challenged and saline -treated groups, respectively. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 3
miR-181 was barely detectable in resting muscle cells [47] and miR-206 was only highly expressed in newly formed muscle fibers [51]. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
In addition, MAPK1 is also a predicted target gene of ssc-miR-204, ssc-miR-129-5p, ssc-miR-194a, ssc-miR-181a, ssc-miR-130a and ssc-miR-101 (Additional file 9). [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
We found that miRNAs with higher expression in WBCs includes different miRNA families: mir-15, mir-17, mir-181, mir-23, mir-27 and mir-29 families. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 2
Guo et al. (2013) report that miR-181 directly impairs PRRSV infection by specifically binding to ORF4 of the viral genomic RNA 8. Here, we aimed to investigate if any cellular miRNA(s) could persistently inhibit PRRSV replication. [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 2
The genetic regulated miRNAs miR-34a, miR-30e, miR-148-3p, miR-204, miR-181-5p, miR-143-5p and let-7g were also correlated with haematological and biochemical traits. [score:2]
[1 to 20 of 1 sentences]
31
[+] score: 2
If we set the threshold of PhastCons score as 0.7, miR-181 can be predicted to bind to the conserved region, as confirmed previously 19. [score:1]
More importantly, miR-181 was also found edited (Supplementary Table S7). [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 1
For example, Hamrick et al., (2010) reported that miR-7, miR-468, miR-542, and miR-698 levels in mouse muscle tissue substantially increased with age, whereas miR-124a, miR-181a, miR-221, miR-382, miR-434, and miR-455 levels substantially decreased with age. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 1 sentences]