sort by

1 publications mentioning eca-mir-222

Open access articles that are associated with the species Equus caballus and mention the gene name mir-222. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 20
Interestingly, miRNA-222/221 which over -expression was noticed in myoblasts undergoing differentiation with its downregulation after differentiation [27] was downregulated in ESC cultures exposed to H [2]O [2] and pretreated with HMB, when compared to control. [score:8]
Taken together, changes in expression of pro-proliferative (miR-133a/b, miR-146a/b, miR-222/221) and differentiation-related miRNAs (miR-1, miR-133a/b, miR-155, miR-193a, miR-204, miR-206, miR-221/222, miR-331, miR-324, miR-374, miR-675) were observed following HMB incubation and exposition of ESC cultures to H [2]O [2], with concomitant changes in expression of their corresponding DET. [score:5]
The analysis confirmed statistically significant differences in the expression of six miRNAs (miR-204, miR-208b, miR-222, miR-675, miR-146a, and miR-146b) and six genes (sod1, sod2, tgfb2, myf5, bdnf, otud4) in HMB -treated ESC when compared to control condition (CTRL) (Fig.   5). [score:2]
Primer’s name Target sequence Amplification time and temperature 1 miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 10 s/95 °C and 60 s/60 °C 2 miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 10 s/95 °C and 60 s/60 °C 3 miR-204b UUCCCUUUGUCAUCCUAUGCCU 10 s/95 °C and 60 s/60 °C 4 miR-208b AUAAGACGAACAAAAGGUUUGU 10 s/95 °C and 60 s/60 °C 5 miR-222 AGCUACAUCUGGCUACUGGGU 10 s/95 °C and 60 s/60 °C 6 miR-675 UGGUGCGGAGAGGGCCCACAGUG 10 s/95 °C and 60 s/60 °C Based on previous studies in different species and the manufacturer recommendation (Exiqon, Denmark), a U6 snRNA reference was used. [score:2]
Primer’s name Target sequence Amplification time and temperature 1 miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 10 s/95 °C and 60 s/60 °C 2 miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 10 s/95 °C and 60 s/60 °C 3 miR-204b UUCCCUUUGUCAUCCUAUGCCU 10 s/95 °C and 60 s/60 °C 4 miR-208b AUAAGACGAACAAAAGGUUUGU 10 s/95 °C and 60 s/60 °C 5 miR-222 AGCUACAUCUGGCUACUGGGU 10 s/95 °C and 60 s/60 °C 6 miR-675 UGGUGCGGAGAGGGCCCACAGUG 10 s/95 °C and 60 s/60 °CBased on previous studies in different species and the manufacturer recommendation (Exiqon, Denmark), a U6 snRNA reference was used. [score:2]
Selected miRNAs (miR-204 (↑), miR-208b (↓), miR-222 (↑), miR-675 (↓), miR-146a (↑), miR-146b (↑)) and genes (bdnf (↓), sod1 (↓), sod2 (↑), tgfb2 (↓), myf5 (↓), otud4 (↑)) were validated by RT-qPCR showing the same trend as in microarray analysis. [score:1]
[1 to 20 of 6 sentences]