sort by

6 publications mentioning eca-mir-486

Open access articles that are associated with the species Equus caballus and mention the gene name mir-486. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 18
Other miRNAs from this paper: eca-mir-454, eca-mir-133b, eca-mir-204b-2, eca-mir-374b
Out of our up-regulated miRNAs, miR-486-5p has not been previously reported to be pregnancy-related, despite being the most highly expressed miRNA within our samples. [score:6]
The two up-regulated miRNAs (miR-204b and miR-486-5p) had an average increase of only 2.4 X (range– 1.44–3.96 X; Fig 2). [score:4]
Overall, expression levels of miR-486-5p increased by an average of 1.6-fold during pregnancy. [score:3]
The number of predicted target mRNAs for each miRNA ranged from 59 (miR-486-5p) to 271 (miR-454; S2 File). [score:3]
Top twenty pathways predicted for miRNAs differentially regulated during pregnancy (miR-133b, miR-204b, miR-454, miR-486-5p). [score:2]
[1 to 20 of 5 sentences]
2
[+] score: 17
In agreement with previous reports of plasma expressed miRNAs in horses, one of the top expressed miRNAs across all samples was eca-miR-486-5p [65]. [score:5]
The miRNA with the highest expression counts was eca-miR-486-5p showing 63% of the total counts (Figure 2B). [score:3]
MiR-486 is known to be highly expressed in blood cells, mainly erythroid cells [67, 68] and was one of the 26 miRNAs significantly affected by the level of hemolysis. [score:3]
From the four miRNAs commonly reported as showing a hemolysis-affected expression (miR-451, miR-16, miR-92a and miR-486p) [32, 39, 66] only eca-miR-486-5p (adjusted p = 2.5 × 10 [−4]) and eca-miR-16 (adjusted p = 0.011) showed a fold-change affected by the level of hemolysis. [score:3]
Of the total counts 86% were contributed by the top five most highly expressed miRNAs (eca-miR-486-5p, eca-miR-92a, eca-miR-191a, eca-miR-423-5p, eca-miR-148a). [score:3]
[1 to 20 of 5 sentences]
3
[+] score: 10
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins. [score:3]
No potential target was identified for eca-miR-486-5p, -223, or -103. [score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries. [score:3]
Among the 10 most abundant plasma miRNAs of the horse (Table 2), the human orthologs of eca-miR-486-5p, -92a, and -21 also belong to the 10 most abundant miRNAs in human plasma [20], which indicates their importance in mammalian plasma. [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 5
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
The absorbance at 414 nm had a significant effect on the expression of eca-miR-25 (FDR = 4.15e-4) and eca-miR-486-5p (FDR = 0.066) that was previously reported as haemolysis dependant [27]. [score:3]
Among the 965 mature miRNAs, we observed that miR-486 was the most abundant, together with a putative novel miRNA identified in the opposite strand of miR-486, which was given here an identifier name ecaub_miR_1177. [score:1]
The four novel miRNAs identified by miRdentify partially overlapped with known miRNAs: the ecaub_novel-miR-1175 was only two nucleotides shorter than eca-mir-744, ecaub_novel-mir-1176 overlapped the position of an Ensembl predicted ENSECAG00000025869, whereas the ecaub_novel-mir-1177 was identified on the opposite strand of the eca-mir-486, and ecaub_novel-mir-1778 was located in the region of another Ensembl predicted ENSECAG00000026103. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 3
A group of miRNAs, highly enriched in skeletal and/or cardiac muscles (myomiRs), has recently been identified and includes miR-1, miR-133a, miR-133b, miR-206, miR-208, miR-208b, miR-486, and miR-499 [14] which regulate skeletal muscle development. [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 1
Additional miRNAs have been reported to participate in skeletal myogenesis and include miR-24 (30), miR-378 (31), miR221/222 (32), miR-486 (33), miR-208b/miR-499 (34) and miR-214 (35). [score:1]
[1 to 20 of 1 sentences]