sort by

3 publications mentioning eca-mir-103

Open access articles that are associated with the species Equus caballus and mention the gene name mir-103. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 21
Hence, upregulation of miR-103 and miR-107 as well as downregulation of miR-744 in asthmatic horses highlight a potential role of this miRNA network in chronic inflammatory conditions. [score:7]
This study reported a deregulation of the cell cycle characterized by an upregulation of various miR-15/16 members, including miR-103 and miR-107a, as well as a downregulation of miR-744. [score:6]
The closely related miRNAs miR-103 and miR-107a are known to pilot cell cycle arrest and their up-regulation in horses suffering from severe equine asthma support previous findings about cell cycle disturbances in equine asthma [33, 97, 98]. [score:4]
Xia W. Ni J. Zhuang J. Qian L. Wang P. Wang J. MiR-103 regulates hepatocellular carcinoma growth by targeting AKAP12Int. [score:3]
Using DESeq2, we identified 11 miRNAs as statistically significant DEmiRs after accounting for the level of hemolysis: eca-miR-128, eca-miR-744, eca-miR-197, eca-miR-103 and the closely related eca-miR-107a, eca-miR-30d, eca-miR-140-3p, eca-miR-7, eca-miR-361-3p, eca-miR-148b-3p and eca-miR-215. [score:1]
[1 to 20 of 5 sentences]
2
[+] score: 6
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries. [score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins. [score:3]
[1 to 20 of 2 sentences]
3
[+] score: 6
Data have been normalized to the endogenous controls miR-26a and miR-103, and are expressed as fold change from unstimulated samples at time 0 (2 [-ΔΔCT]). [score:3]
0177664.g005 Fig 5PCR data have been normalized to the endogenous controls miR-26a and miR-103. [score:1]
PCR data have been normalized to the endogenous controls miR-26a and miR-103. [score:1]
Data were normalized to the geometric mean of two endogenous controls, miR-26a-5p and miR-103. [score:1]
[1 to 20 of 4 sentences]