sort by

5 publications mentioning eca-mir-191a

Open access articles that are associated with the species Equus caballus and mention the gene name mir-191a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 9
Ten plasma miRNA species exhibiting the highest expression levels in the libraries are listed with their characteristics in Table 2. These accounted for 68.6% of total plasma miRNA reads, and the three most highly expressed miRNA species, eca-let-7f, -7a, and eca-miR-191a, accounted for 40.6%. [score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 (A) Venn diagram representing the numbers of miRNA species identified in the libraries. [score:3]
miRNA Mature sequence Location Potential target genes CPM per total CPM (%) eca-let-7f UGAGGUAGUAGAUUGUAUAGUU Chr23: 54150758–54150844 [–] PKD1L3, SETD9, SOS2, SRPK2, WAC 16.9 eca-let-7a UGAGGUAGUAGGUUGUAUAGUU Chr7: 29543908–29543979 [–] WAC 13.2 eca-miR-191a CAACGGAAUCCCAAAAGCAGCUG Chr16: 38001159–38001232 [+] IL13RA1, TRPM3 10.5 eca-let-7g UGAGGUAGUAGUUUGUACAGUU Chr16: 35442180–35442267 [+] ACSM3, BTRC, CDH7, RIMS2, WAC, WDR20, ZSWIM5 7.58 eca-miR-486-5p UCCUGUACUGAGCUGCCCCGAG Chr27: 3709569–3709634 [+] Not Found 5.90 eca-miR-24 UGGCUCAGUUCAGCAGGAACAG Chr7: 44930163–44930230 [+] AHDC1, AVEN, DCAF10, KANSL3, OTOP1 3.16 eca-miR-223 UGUCAGUUUGUCAAAUACCCCA ChrX: 48492588–48492691 [+] Not Found 3.07 eca-miR-21 UAGCUUAUCAGACUGAUGUUGA Chr11: 33863745–33863816 [+] ESR1, SMARCA2, ZNF800 2.91 eca-miR-92a UAUUGCACUUGUCCCGGCCUGU Chr17: 61793120–61793180 [+] STT3A 2.87 eca-miR-103 AGCAGCAUUGUACAGGGCUAUGA Chr14: 12370468–12370539 [+] Not Found 2.52 Total 68.6 As shown in the dendrogram at the top of Fig 2, samples were clustered according to tissue origins. [score:3]
[1 to 20 of 3 sentences]
2
[+] score: 5
The majority of miRNAs (76%) showed high expression level (10 AC 100), 13 miRNAs (16%) had AC lower than 10, whereas 6 miRNAs-MIR34B, MIR34C, MIR191, MIR223, MIR1248, and MIR1905C-showed very high expression levels (AC≥100) in stallion sperm (Table S7). [score:5]
[1 to 20 of 1 sentences]
3
[+] score: 4
Other highly expressed miRNAs common to human and equine PBMCs include miR-191a and miR-150 [36, 37]. [score:3]
For example, let-7g, miR-21 and miR-191a are among the most abundant miRNAs in both PBMCs and plasma of horses, while miR-150 features prominently in PBMCs and whole blood. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 3
Of the total counts 86% were contributed by the top five most highly expressed miRNAs (eca-miR-486-5p, eca-miR-92a, eca-miR-191a, eca-miR-423-5p, eca-miR-148a). [score:3]
[1 to 20 of 1 sentences]
5
[+] score: 1
The hsa-miR191 (#204306, Exiqon, Denmark)) was used as endogenous control. [score:1]
[1 to 20 of 1 sentences]