sort by

2 publications mentioning bta-mir-2366

Open access articles that are associated with the species Bos taurus and mention the gene name mir-2366. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 3
Other miRNAs from this paper: bta-mir-221, bta-mir-222, bta-mir-30d, bta-mir-30b, bta-mir-10a, bta-mir-30e, bta-mir-10b, bta-mir-30a, bta-mir-30c, bta-mir-331, bta-mir-135a-2, bta-mir-135a-1, bta-mir-188, bta-mir-30f, bta-mir-670, bta-mir-873, bta-mir-1839, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2306, bta-mir-2308, bta-mir-2309, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2389, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2422, bta-mir-2284r, bta-mir-2284h, bta-mir-2448, bta-mir-2284o, bta-mir-2284e, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-6525, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Three miRNAs, bta-miR-10a/b and bta-miR-6525, were shared by MY and mastitis, and bta-miR-2366 was shared by FY and mastitis, the targets of which were engaged in MAPK signaling pathway, AMPK signaling pathway, Ras signaling pathway, salmonella infection, and fructose and mannose metabolism. [score:3]
[1 to 20 of 1 sentences]
2
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
miRNA-name precusor-miRNA Minimum free energy(kcal/mol) bta-mir-1343 GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCC CTCCTGGGGCCCGCACTCTCGCTCCGGGCC ssc-mir-1343 GGCTTCGGTGCTGGGGAGCGGCCCCCGGGCGGGCCTCTGCTCTGGCCC CTCCTGGGGCCCGCACTCTCGCTCCGGGTC −50.3 bta-mir-2320 TGTCCCCA TGGCACAGGGTCCAGCTGTCGGCCGTGATACCCGATGGGTCGATGATGGTCCCTGTGTTTTGGGGCG ssc-mir-2320 TGTCCCCA TGGCACAGGGTCCAGCTGTCGGCTGTAATACCCGATGGGTCGATGATGGTCCCTGTGTTTGGGGCG −37.7 bta-mir-2366 CCCCGGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGTGC TGGGTCACAGAAGAGGGTCTGGGGG ssc-mir-2366 CCCCAGGGTCCTCTTGTCTGAGCCCCAGAAAGAGGAGAGAGCGC TGGGTCACAGAAGAGGGTCTGGGGG −31.6 bta-mir-2411 GAGGAAATG TGGAGTGACTGTCAGATGCAGCCAGCAGAATAAGTGGTTTGGCTGAACTGTCTTACTCCCACATCCTC ssc-mir-2411 GAGGCAATGT GGAGTGACTGTCAGATGCAGCCATCAGAATAGGTGATTTGGCTGAACTGTCATACTCCCACATCCTC −29.2 bta-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGAGGTGATGC AAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT ssc-mir-2483 GAGTGAAAAGTTCCGTCAACCATCCAGCTGTTTGGGGTGATGC AAACAAACATCTGGTTGGTTGAGAGAATTTTTTACTT −37.3 Note: The bold are the mature miRNA sequences. [score:1]
[1 to 20 of 1 sentences]