sort by

21 publications mentioning ssc-mir-146b

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-146b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 114
Coexpression of miR-146b-3p mimic, but neither miR-146b-5p mimic nor negative control (NC), significantly suppressed the GLuc luciferase reporter activity of the linked 3′-UTR, indicating that miR-146b-3p suppresses ADA2 expression through miRNA binding [20] sequences in its 3′-UTR (Figure 2(b)). [score:9]
Together, these results suggest that miR-146b-3p suppresses ADA2 expression by binding to the 3′-UTR and that ADA2 is a direct target of miR-146b-3p. [score:8]
We hypothesize that as a negative regulator of ADA2, miR-146b-3p expression may be inversely associated with ADA2 expression or activity and the status of inflammation. [score:6]
The result also shows that miR-146b-3p expression levels were downregulated in the diabetic samples after normalizing with housekeeping HsRNU6. [score:6]
ADA2 expression and TNF- α release were both significantly increased after AGA treatment (Figure 4), whereas expression of miR-146b-3p was significantly decreased after AGA treatment (Figure 4). [score:5]
Our results confirm the hypothesis that miR-146b-3p binds to ADA2 3′-UTR and inhibit its expression and activity. [score:5]
In addition, miR-146b-5p, an miRNA regulated by variable globular adiponectin concentrations and acting as an inhibitor of NF κB-, but not ADA2 -mediated inflammation, is decreased in circulating monocytes of obese subjects with type 2 diabetes [15]. [score:4]
We hypothesize that increased ADA2 production might result from the downregulation of miR-146b-3p. [score:4]
ADA2 Is a Direct Target of miR-146b-3p. [score:4]
To determine whether miR-146-3p is dysregulated in diabetes, we first determined the effect of miR-146b-3p overexpression in PMA-differentiated U937 monocytes. [score:4]
miR-146b-5p and miR-146b-3p are two isoforms from the same gene in human chromosome 10 with different sequences and for the regulation of different gene expression. [score:4]
miR-146b-5p, an miRNA regulated by variable globular adiponectin concentrations and acting as an inhibitor of NF κB -mediated inflammation, is decreased in circulating monocytes of obese subjects with type 2 diabetes [15, 20]. [score:4]
These results suggest a role of miR-146b-3p in the regulation of retinal inflammation in diabetes by suppressing ADA2. [score:4]
It is likely that, in addition to ADA2, there are other genes that are upregulated by miR-146b-3p silencing in diabetes. [score:4]
We identified a role of miR-146b-3p in the regulation of retinal inflammation in diabetes by suppressing ADA2. [score:4]
In contrast to the well-studied miR-146b-5p, the targets of miR-146b-3p involved in diabetes are not well studied. [score:3]
The increased ADA2 activity is also associated with decreased expression of miR-146b-3p in diabetes. [score:3]
Database searches of the TargetScan sites showed that human ADA2 mRNAs have conserved miR-146b-3p recognition sites (Figure 2(a)). [score:3]
We then determined ADA2 activity and miR-146b-3p expression in the vitreous of human donor eyes with (n = 8) and without diabetes (n = 4). [score:3]
RNA was extracted from the treated cells, and expression levels of ADA2 and miR-146b-3p were determined by quantitative (q) RT-PCR. [score:3]
miR-146b-3p may serve as a therapeutic target for early detection and intervention of DR. [score:3]
In the current study, we demonstrate that ADA2 is one of the targets of miR-146-3p. [score:3]
Moreover, ectopic expression of miR-146b-3p decreases the ADA2 activity and TNF- α release in PMA-differentiated U937 monocytes. [score:3]
Taken together, these results suggest that an inverse correlation between miR-146b-3p and inflammation occurs in diabetes and that reduction or dysregulation of miR-146-3p may contribute to diabetic complications. [score:2]
In contrast to miR-146b-5p, genes that are negatively regulated by miR-146b-3p in diabetes have not been identified. [score:2]
3.3. miR-146b-3p Is Dysregulated in Diabetes. [score:2]
An aliquot of 10 [6] U937 cells were pelleted and resuspended in 100  μL electroporation buffer (VCA-1004) containing negative control (NC), miR-146-5p mimic, or miR-146b-3p mimic at a final concentration of 100 nM. [score:1]
Luciferase reporter analysis shows that luciferase activity decreases with cotransfection of miR-146b-3p but not NC or miR-146b-5p. [score:1]
3.4. miR-146b-3p Is Inversely Associated with ADA2 in Diabetes. [score:1]
For miR-146b-3p and miR-146b-5p quantitation, total RNA isolated from cells or vitreous were reverse-transcribed into cDNA using miScript reagents (Qiagen). [score:1]
Evaluation of the cell lysates showed that the miR-146b-3p -transfected cells exhibited reduced ADA2 expression, activity, and TNF- α release (Figure 3). [score:1]
Cells were cotransfected with 100 nM miR-146b-3p mimic, miR-146b-5p mimic, or NC and 1  μg of pEZX-MT05 with or without the 3′-UTR of the human ADA2 gene. [score:1]
PMA -treated cells were transfected with nucleofector technology with negative control (NC), miR-146b-3p mimic, and exposed to AGA. [score:1]
To test this hypothesis, we measured the miR-146b-3p level, ADA2 expression, and tumor necrosis factor (TNF)- α release after AGA treatment of PMA-differentiated U937 monocytes. [score:1]
Our bioinformatics analysis showed that ADA2 mRNA has 3′-UTR site which is complimentary to miR-146b-3p. [score:1]
[1 to 20 of 35 sentences]
2
[+] score: 39
In the current study, we demonstrated that miR-146b expression was significantly upregulated by CLA treatment, but miR-146b showed no significant correlation with the selected adipocyte genes, suggesting that miR-146b possibly regulates lipogenesis by impacting other fat-related genes in porcine adipose tissue. [score:7]
A study by Chen et al. reported that miR-146b could inhibit the proliferation of human visceral preadipocytes and promote cell differentiation by inhibiting the expression of Kruppel-like transcription factor7 (KLF7). [score:7]
Diets with 1.5% CLA caused the expression of ssc-miR-21 and ssc-miR-146b to be upregulated at 30, 90, and 240 days old in subcutaneous adipose tissues, and at 240 days old in abdominal adipose tissues. [score:6]
We further analysed correlations between the expression of DE miRNAs (ssc-miR-21 and ssc-miR-146b) and the adipocyte phenotype. [score:3]
Chen L. Dai Y. M. Ji C. B. Yang L. Shi C. M. Xu G. F. Pang L. X. Huang F. Y. Zhang C. M. Guo X. R. MiR-146b is a regulator of human visceral preadipocyte proliferation and differentiation and its expression is altered in human obesityMol. [score:3]
On the other hand, another DE miRNA, miR-146b, was highly expressed in mature adipocytes. [score:3]
Ssc-miR-21 and ssc-miR-146b were expressed differentially in both adipose tissues. [score:3]
Ahn J. Lee H. Jung C. H. Jeon T. I. Ha T. Y. MicroRNA-146b promotes adipogenesis by suppressing the SIRT1-FOXO1 cascadeEMBO Mol. [score:2]
miR-146b directly bound to SIRT1, which plays a key role in metabolic homeostasis and promotes fat mobilization in white adipose tissue. [score:2]
The miR-146b/SIRT1 axis mediates adipogenesis through increased acetylation of forkhead box O1 (FOXO1) in 3T3-L1 cells [32]. [score:1]
Among these 14 DE miRNAs, miR-21 and miR-146b were identified in both adipose tissues and we speculated that they played a crucial role in adipogenesis by CLA treatment. [score:1]
Moreover, miR-146b was also confirmed to be an important mediator in adipose tissue inflammation [33, 34]. [score:1]
[1 to 20 of 12 sentences]
3
[+] score: 31
P38 MAPKs (MAPK11, MAPK13, and MAPK14) were found to be regulated by miR-769-5p, miR-146b-5p, let-7g, miR-30b, miR-31, miR-361-3p, and miR-362-3p (Figure 7), which were all down expressed in H1N1 critically ill patients. [score:4]
Schmidt et al. [78] found that miR-146b-5p, miR-150, miR-342-3p and let-7g were downregulated in peripheral blood leukocytes during acute lipopolysaccharide (LPS) induced inflammation, which was similar to our result. [score:4]
We found that EGFR was regulated by miR-342, miR-155, miR-30b, miR-210, miR-192, let-7g, and miR-146b-5p, which were all down expressed in H1N1 critically ill patients. [score:4]
Taken together, our findings suggest the downregulation of miR-146b-5p and let-7g were important in further understanding the molecular mechanisms implicated in obese patients susceptive to severe infection of H1N1 influenza virus. [score:4]
The expression of hsa-miR-150, hsa-miR-31, hsa-miR-155, hsa-miR-29a, hsa-miR-29b, hsa-miR-342-5p, and hsa-miR-146b-5p were present in lower abundance, whereas hsa-miR-148a and hsa-miR-886-3p were present in higher abundance in PBMCs from critically ill patients infected with H1N1 influenza virus than that from healthy controls. [score:3]
validation of differentially expressed miRNAs and ROC analysisThe microarray data were validated by performing, qRT-PCR for nine miRNAs, including hsa-miR-146b-5p, hsa-miR-148a, hsa-miR-150, hsa-miR-31, hsa-miR-155, hsa-miR-29a, hsa-miR-29b, hsa-miR-342-5p, and hsa-miR-886-3p. [score:3]
A recent study reported that the expression of miR-146b-5p was decreased in monocytes during obesity [76]. [score:3]
MiR-146b-5p acts as an inhibitor of NF-κB -mediated inflammation and is necessary for the anti-inflammatory action of high levels of globular adiponectin. [score:2]
The expression level of miR-146b-5p was only slightly decreased in critically ill patients compared to controls with no significant difference (P > 0.05). [score:2]
The microarray data were validated by performing, qRT-PCR for nine miRNAs, including hsa-miR-146b-5p, hsa-miR-148a, hsa-miR-150, hsa-miR-31, hsa-miR-155, hsa-miR-29a, hsa-miR-29b, hsa-miR-342-5p, and hsa-miR-886-3p. [score:1]
However, miR-146b-5p could not discrimiate critically ill patients effectively due to the P value of ROC analysis was higher than 0.5(Figure 5). [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 30
In addition, miR-215 and miR-146b out of all differentially expressed miRNAs were particularly interested, because the former had the abundant expression levels in all libraries and was one of several miRNAs that had a downregulated trend in the weaning groups, and the latter had the largest differences in expression levels between two pairs of W4 and S4, W7 and S7. [score:10]
In this study, miR-146b out of all miRNAs differentially expressed had the largest range at 4 d after weaning and had a sustaining difference at 7 d after weaning; miR-215 out of all miRNAs detected in all libraries showed the abundant expression level and was one of several downregulated expression miRNAs in the weaning groups. [score:10]
Only 3 miRNAs (miR-155, miR-150-1 and miR-204) at W1 and W4, and 4 miRNAs (miR-132, miR-146b, miR-212 and miR-218-2) at W4 and W7 were consistently upregulated across two of three time points. [score:4]
miR-146b was significantly upregulated during stages I, II and III of papillary thyroid carcinoma [44]. [score:4]
Increasing evidence has revealed that the miR-146 family (miR-146a and miR-146b) mediates IRAK1 (interleukin 1 receptor -associated kinase) and TGF-β (transforming growth factor-β) signaling pathways through negative feedback regulation during intestinal epithelial cell differentiation and in the mucosal immune system [45], [46]. [score:2]
[1 to 20 of 5 sentences]
5
[+] score: 26
Five upregulated (miR-146a-5p, miR-146b, miR-365-3p, miR-92a, and miR-181c) and five downregulated (miR-30b-3p, miR-214, miR-140-3p, miR-664-3p, and miR-1307) miRNAs from the microarray were selected randomly to conduct real-time PCR. [score:7]
Taganov K. D., Boldin M. P., Chang K. J., and Baltimore D. 2006 NF-kappa B -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses. [score:5]
miR-146a-5p and miR-146b showed the highest upregulation levels of 10.24-fold and 13.62-fold, respectively, in the TNF-α group. [score:4]
Because the signal value of miR-146a-5p was higher than that of miR-146, we assumed that miR-146a-5p would be expressed at a higher level than that of miR-146b in adipocytes. [score:3]
The fact that miR-146a-5p exhibited a higher signal value indicated that it generally was expressed at a higher average degree than miR-146b in normal porcine adipocytes. [score:3]
Expression levels of miR-146a-5p and miR-146b were the most drastically changed at 10.24-fold and 13.62-fold, respectively, by TNF-α treatment of adipocytes. [score:3]
These results suggest that miR-146-5p participates in TNF-α -induced insulin resistance and the insulin signaling pathway. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 16
Among them, let-7 g, miR-17-5p, miR-17-3p, miR-20a, miR-181a, miR-16, miR-146b, miR-10b, and miR-155-5p were upregulated; let-7c, miR-122, miR-18a, miR-19a, miR-19b, miR-196b, miR-21, and miR-9 were downregulated. [score:7]
However, we did not detect differential expression of other previously identified miRNAs (miR-223, miR-150, miR-92a), although miR-10b, miR-20a, miR-30a-5p, miR-34a, miR-17—5p, miR-16, miR-146b, and miR-155-5p expression was significantly different. [score:5]
We detected the expression of miR-10b, miR-20a, miR-19b, miR-181a, miR-146b, miR-18a, and other previously identified immune-related miRNAs. [score:3]
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 14
GO annotation was performed for the target genes of five designated differentially expressed miRNAs (miR-146b, miR-155–5p, miR-195, miR-124a and miR-1306–5p). [score:5]
In this study, the sequencing data confirmed the results of previous studies, and proved that in addition to immune cells, normal cells also abundantly expressed miR-146 and miR-155 when stimulated by viral antigens and are involved in the regulation of immunity. [score:4]
In particular, mature miR-146 and miR-155 were significantly upregulated in infected ST cells compared with the control group; the fold changes of miR-146 and miR-155 between the infected ST cells and the control group were 3.30 and 1.74, respectively. [score:3]
Previous research showed that miR-146 and miR-155 play a key regulatory role on host immune function. [score:2]
[1 to 20 of 4 sentences]
8
[+] score: 11
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Furthermore, Qiang et al. (2017b) found three miRNAs (miR-310, miR-92, and miR-127) that were upregulated and four (miR-92d, miR-375, miR-146, and miR-694) that were downregulated by comparing a control group of Nile tilapia with a group infected with Streptococcus iniae. [score:7]
They recorded changes in the expression levels of eight miRNAs (miR-1a, miR-181a, miR-133a, miR-214, miR-133b, miR-206, miR-146, and miR-26a) shown to be involved in a strong resumption of myogenesis (Zhu et al., 2014). [score:3]
Seven miRNAs (miR-126-3p, miR-101a, miR-451, miR-22a, miR-146, miR-142a-5p, and miR-192) were found to have optimal stability and should be individually prioritized according to the stage and tissue of interest. [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 10
Knockdown of TRAF6 and mutation of MYD88 showed that the induction of miR-146a and miR-146b by Salmonella Typhimurium infection was affected by disruption of the MYD88-TRAF6 pathway, which mediates the transduction of the TLR signals and cytokine responses [11]. [score:3]
The miR-146 family members are known as inflammation inducible miRNAs involved in the negative feedback regulation of toll-like receptor (TLR) signalling [9]. [score:2]
In zebrafish, miR-146a and miR-146b were commonly induced by infection of embryos with Salmonella Typhimurium [11]. [score:1]
Previous studies found that miR-146 and miR-155 were co -induced in macrophage cells in response to microbial LPS [7– 9]. [score:1]
In addition to miR-146 and miR-155, the let-7, miR-15, miR-128 and miR-29a also have roles in Salmonella infection. [score:1]
Analysis of host miRNA by high throughput sequencing confirmed the co-induction of miR-146 and miR-155 upon live microbial infection with wild type (WT) Salmonella Typhimurium strains [10]. [score:1]
In human monocytes, the miR-146 and miR-155 can respond to endotoxins and a variety of microbial components and pro-inflammatory cytokines [9]. [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
11
[+] score: 9
We also found that ssc-miR-146a-5p and ssc-miR-146b were expressed at higher level in HG-IEN samples, which accords with findings in humans that these are expressed at higher levels in colon tumours than adjacent normal tissue, and are involved in CRC invasion [21, 22]. [score:5]
Ten differentially expressed miRNAs were validated by qRT-PCR: ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-155-5p, ssc-miR-181b, ssc-miR-183, ssc-miR-191 and ssc-miR-196a. [score:3]
In summary, we have detected several miRNAs (ssc-let-7e, ssc-miR-98, ssc-miR-126-3p, ssc-miR-146a-5p, ssc-miR-146b, ssc-miR-183 and ssc-miR-196a) associated with early-stage colorectal neoplasia in APC [1311] pigs. [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 9
Moreover, 13 miRNAs were differentially expressed: 8 were upregulated (ssc-miR-132, ssc-miR-146b, ssc-miR-215, ssc-miR-371, ssc-miR-27a, ssc-miR-331-3p, ssc-miR-432-5p and ssc-miR-199a/b-3p), while 5 were down-regulated after PRV infection (ssc-mir-10a-5p, ssc-mir-148-3p, ssc-mir-219a, ssc-mir-374b-3p and ssc-miR-532-5p) (Fig 7). [score:9]
[1 to 20 of 1 sentences]
13
[+] score: 7
Other miRNAs from this paper: ssc-mir-146a
Impaired cytokine production following TLR agonist challenge in preterm pigs at birth is likely due to defective expression of leukocyte receptors, such as CD14, TLRs 12, or of second-messenger signaling intermediates, such as IRAK-4 or MyD88 proteins 8. Interestingly, previous mechanistic studies revealed that inhibition of the intermediate IRAK-4 is derived from the action of microRNAs, such as miR146, which is highly expressed in cord blood monocytes, relative to adult monocytes 40. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 6
Take MAPK signaling pathway for instance, as shown in Fig. S1A, on PID 4, there are 38 DE miRNAs involved in MAPK signaling pathway and most DE miRNAs such as miR-450b-5p, miR-146b, miR-1343, miR-128, and miR-30a-5p were down-regulated while their targets such as MEF2C, NFKB1, TGFBR1, EGFR, JUN, and MAPK1 are key factors in MAPK signaling pathway (see map 04010 in KEGG database). [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 6
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
The results showed that 9 miRNAs were significantly different between the two libraries, such as the expression of miR-215, miR-135 and miR-146b was higher in Large White pigs, opposite to the patterns shown by miR-1a, miR-133a, miR-122, miR-204 and miR-183 (Table 1), suggesting that these miRNAs may have effects on the development of backfat tissue. [score:4]
For example, ssc-miR-153, miR-325, miR-135-1*, miR-135-2*, miR-146b*, miR-15a*, miR-215* and miR-323* were only identified in Large White, contrary to the patterns displayed by ssc-miR-101a-1*, miR-103*, miR-183*, miR-1a* and miR-210*, indicating that these miRNAs may function in the physiology or development of the backfat tissue. [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 6
Among the 20 specific DEmiRNAs in Landraces' lungs, six DEmiRNAs (ssc-let-7i, ssc-miR-122, ssc-miR-195, ssc-miR-146b, ssc-miR-146a-5p, ssc-miR-30b-5p) had an expression value (TMM) larger than 10,000 at 0 dpi and all of them were down-regulated significantly at 3, 5, 7 dpi (Table 3). [score:6]
[1 to 20 of 1 sentences]
17
[+] score: 5
Taganov K. D. Boldin M. P. Chang K. J. Baltimore D. NF-κB -dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responses Proc. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 3
The expression levels of 17 immune-related miRNAs, including miR-10b, miR-20a, miR-19b, miR-181a, miR-146b, and miR-18a were found to be significantly altered in PK-15 cells during PPV infection. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Tao et al. (2013) conducted miRNA sequencing on jejunum tissue of newborn litters of crossbred piglets (DYL, originating from mating Duroc boars with Yorkshire-Landrace sows) and found that the expression of miR-215 and miR-146b were significantly different at different days (P < 0.05) [30]. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 1
To verify the accuracy of the high-throughput sequencing results, stem-loop quantitative (q)RT-PCR was performed on 12 significantly DE miRNAs (ssc-miR-10b, ssc-miR-486, ssc-miR-24-3p, ssc-miR-195, ssc-miR-19b, ssc-let-7f, ssc-miR-146b, ssc-miR-novel-chr16_17559, ssc-miR-novel-GL892871-2_41708, ssc-miR-novel-chr2_21624, ssc-miR-novel-chr12_7961, and ssc-miR-26a). [score:1]
[1 to 20 of 1 sentences]