sort by

28 publications mentioning sly-MIR172b

Open access articles that are associated with the species Solanum lycopersicum and mention the gene name MIR172b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 74
miRNA Fold (↑ or ↓) Target protein class Function References miR160 ↓, 2X Auxin response factors Hormone signaling and plant development[50] miR162 ↑, 2X Dicer-like (DCL) protein Plant development[39] miR168 ↑, 2X ARGONAUTE (AGO) protein Plant development[40, 51] miR169 ↓, 2X CBF HAP2-like factors Abiotic stress responses[52] miR171 ↓, 2X Scarecrow- like (GRAS domain) TFs Flowering time[11] miR172 ↑, ~4X APETALA-2 (AP2) like TFs Floral identity and phase transition[13, 17] miR319 ↑, ~4X TCP, bHLH TF Leaf patterning[19] miR391 ↓, 3X Not known Not known miR396 ↑, 2X GRL TFs, Rhodanase like proteins Defense responses[23] miR397 ↑, 1.5X Laccases, b -6 tubulin Fungal infection[7, 23] miR398 ↑, 3X Copper superoxide dismutases (CSD1/2) Abiotic stress[43] miR408 ↑, 1.5X Plantacyanin Stress responses[23] miR447 ↑, 2.5X 2-Phosphoglycerate kinase Metabolic pathway[7]The relative expression values of the individual miRNAs as revealed from the array analysis have been plotted as a histogram (see Additional file 1; Fig. S 2 a, b). [score:8]
miRNA Fold (↑ or ↓) Target protein class Function References miR160 ↓, 2X Auxin response factors Hormone signaling and plant development[50] miR162 ↑, 2X Dicer-like (DCL) protein Plant development[39] miR168 ↑, 2X ARGONAUTE (AGO) protein Plant development[40, 51] miR169 ↓, 2X CBF HAP2-like factors Abiotic stress responses[52] miR171 ↓, 2X Scarecrow- like (GRAS domain) TFs Flowering time[11] miR172 ↑, ~4X APETALA-2 (AP2) like TFs Floral identity and phase transition[13, 17] miR319 ↑, ~4X TCP, bHLH TF Leaf patterning[19] miR391 ↓, 3X Not known Not known miR396 ↑, 2X GRL TFs, Rhodanase like proteins Defense responses[23] miR397 ↑, 1.5X Laccases, b -6 tubulin Fungal infection[7, 23] miR398 ↑, 3X Copper superoxide dismutases (CSD1/2) Abiotic stress[43] miR408 ↑, 1.5X Plantacyanin Stress responses[23] miR447 ↑, 2.5X 2-Phosphoglycerate kinase Metabolic pathway[7] The relative expression values of the individual miRNAs as revealed from the array analysis have been plotted as a histogram (see Additional file 1; Fig. S 2 a, b). [score:8]
Northern hybridization results clearly showed that miR159 and miR172 expression levels were induced with increasing dpi of ToLCNDV infection and this accumulation was directly linked to the disease severity (Figure 8a). [score:6]
The expression analysis of miR159 and miR172 at different dpi of ToLCNDV (2A+2B) infected Pusa Ruby leaves clearly shows induction of these miRNA during disease progression (Figure 8a). [score:5]
The expression levels of miR159/319 and miR172 were observed to be associated with disease progression, thereby making these as potential biomarkers for ToLCNDV infection. [score:5]
Most of the miRNAs listed in the heat map were up-regulated with statistical significance and these include miR162, miR168, miR172, miR319, miR396, miR397, miR398, miR408 and miR447 (Figure 2). [score:4]
Levels of miR159 and miR172 increase significantly as the ToLCNDV disease symptoms progress. [score:3]
Tissues obtained from healthy tomato (cv Pusa Ruby; lane 3), ToLCNDV infected tomato (cv Pusa Ruby; lane 2) and LA1777 (lane 1) plants were checked for the expression of miR159 (1 [st ]panel) and miR172 (2 [nd ]panel). [score:3]
These observations lend strong support to our previous observation that miR159, miR319 and miR172 levels increase with the disease progression [33]. [score:3]
As observed in Figure 3, miR159, miR172 and miR319 were up-regulated approximately by 4, 5 and 3 folds, respectively, in ToLCNDV (2A+2B) infected leaves as compared to both healthy leaves and LA1777 leaves (Figure 3, lanes 1 and 3). [score:3]
The leaves of ToLCNDV agroinfected plants were checked for the levels of miR159 and miR172 at different dpi since these miRNAs showed induced expression levels in microarray results. [score:3]
When flowers of the corresponding plants were analyzed for the expression levels of miR159 and miR172, we observed patterns dissimilar from those of the leaves. [score:3]
Leaves obtained at 28dpi, showed maximum expression of both, miR159 (~3.2 folds) and miR172 (~3.7 folds). [score:3]
Microarray analyses of miRNAs, isolated from the leaves of both healthy and ToLCNDV agroinfected tomato cv Pusa Ruby, revealed that ToLCNDV infection significantly deregulated various miRNAs representing ~13 different conserved families (e. g., miR319, miR172, etc. [score:2]
We used miR159, miR164, miR170/171, miR172 and miR319 for these studies as they are involved in leaf/shoot development as well as stress responses [19- 21]. [score:2]
This suggests that ToLCNDV induced deregulation of few mature miRNAs, namely miR159 and miR172, occurred specifically to the leaf tissues. [score:2]
The DNA oligos used as probes for northern analysis are given below: miR159: 5' - TAGAGCTCCCTTCAATCCAAA- 3'; miR164: 5' - TGCACGTGCCCTGCTTCTCCA- 3'; miR171: 5' - AGATGATATTGGCACGGCTCA- 3'; miR172: 5' - ATGCAGCATCATCAAGATTCT -3'; miR319: 5' - CTTGGACTGAAGGGAGCTCC-3'; Total RNA from healthy Pusa Ruby, ToLCNDV (2A+2B) agroinfected Pusa Ruby and LA1777 leaves and flowers was prepared using an RNeasy plant mini kit (Qiagen). [score:1]
The DNA oligos used as probes for northern analysis are given below: miR159: 5' - TAGAGCTCCCTTCAATCCAAA- 3'; miR164: 5' - TGCACGTGCCCTGCTTCTCCA- 3'; miR171: 5' - AGATGATATTGGCACGGCTCA- 3'; miR172: 5' - ATGCAGCATCATCAAGATTCT -3'; miR319: 5' - CTTGGACTGAAGGGAGCTCC-3'; Total RNA from healthy Pusa Ruby, ToLCNDV (2A+2B) agroinfected Pusa Ruby and LA1777 leaves and flowers was prepared using an RNeasy plant mini kit (Qiagen). [score:1]
These results suggest that miR159 and miR172 could be used as potential indicator of ToLCNDV infection. [score:1]
Figure 8 Northern analysis of miR159 and miR172 at different days post inoculation (dpi) of ToLCNDV construct. [score:1]
Together, these results strongly suggest that certain miRNAs (e. g., miR159/319 and miR172) could be associated with the ToLCNDV infection as well as pathogenesis. [score:1]
Figure 4 Northern analysis of miR159 and miR172 levels in flower samples. [score:1]
Interestingly, with flower tissues, no significant changes were observed for miR160 and miR172 precursor levels (Figure 5b) during ToLCNDV infection. [score:1]
The precursors of miR162, miR172, miR395, miR397 and miR399 were induced to more than five folds in ToLCNDV infected leaves, while those of miR159, miR160, miR167 and miR319 showed almost 2-3 times increase in ToLCNDV infected leaves (Table 3). [score:1]
The accumulation of miR159/319 and miR172 was observed to increase with the days post inoculation (dpi) of ToLCNDV agroinfection in tomato cv Pusa Ruby. [score:1]
Our results indicate that miR159/319 and miR172 might be associated with leaf curl symptoms. [score:1]
The levels of miR159, miR172 and miR319 were induced following ToLCNDV agroinfection The experiments were conducted thrice. [score:1]
[1 to 20 of 27 sentences]
2
[+] score: 61
To verify whether increased expression of miR172 may explain some of the phenotypes, miR172 expression levels were quantified in NbTM8-VIGS and NbSVP-VIGS lines. [score:5]
TM8 SVP VIGS Nicotiana benthamiana Repressor of miR172 RNAi Overexpression Solanum lycopersium Petunia hybrida MIKC [C]-type MADS-box genes are plant transcription factors involved in diverse developmental processes [1– 3]. [score:4]
The results show that miR172 is strongly upregulated in the VIGS lines in comparison to EV control plants (Fig. 3g, h). [score:4]
e Relative expression of miR156 (left) and miR172 (right) during Nicotiana development. [score:4]
C) Trichome density increases faster in two Nicotiana transgenic lines overexpressing miR172 (L6 and L7). [score:3]
t Relative expression levels of NbTM8 and miR172 in inflorescence tissue of control and 35S: NbTM8 lines. [score:3]
h Relative expression of NbSVP, miR172 and NbTM8 in NbSVP-VIGS and control plants. [score:3]
Finally we would like to thank Xuemei Chen (UC Riverside) for the transgenic miR172 overexpression lines. [score:3]
g Relative expression of NbTM8, miR172 and NbSVP in inflorescence tissue of NbTM8-VIGS and control plants. [score:3]
In agreement with this hypothesis we found that the first peak in NbTM8 expression coincides almost perfectly with the moment that miR156 drops below the increasing miR172 level. [score:3]
Given the above data, it is plausible that NbTM8 and NbSVP act as negative regulators of miR172 in Nicotiana and may control the timing of developmental transitions together by repressing miR172 levels. [score:3]
Interestingly, the observed phenotypes strongly resemble those of Nicotiana plants that constitutively express Arabidopsis miR172 (Fig. 3a–c) [30]. [score:3]
To examine the expression of selected genes and microRNA’s (NbTM8, NbSVP, NbSOC1, NbAP1, miR156 and miR172), qRT-PCR was used. [score:3]
A good candidate would be SHORT VEGETATIVE PHASE (SVP), another MADS-box gene involved in the floral transition by down regulation of miR172 in Arabidopsis [27]. [score:2]
Both in 35S: NbTM8 and 35S: NbSVP lines, miR172 was significantly down regulated (Fig. 3t, u). [score:2]
Through knock-down of NbTM8 by virus induced gene silencing in Nicotiana benthamiana, we show that NbTM8 represses miR172 together with another MADS-box gene, SHORT VEGETATIVE PHASE (NbSVP). [score:2]
These observations suggest that NbTM8 acts during both phase transitions in Nicotiana, possibly by regulating miR156 and miR172. [score:2]
While TM8 seems to perform a function as repressor of miR172 in Nicotiana benthamiana, its function seems to have diverged quickly between members of the same family. [score:1]
We have shown that in Nicotiana benthamiana the TM8 orthologue NbTM8 functions as a repressor of miR172. [score:1]
u qPCR of NbSVP and miR172 in inflorescence tissue of control and 35S: NbSVP. [score:1]
NbTM8 and NbSVP repress miR172 in Nicotiana benthamiana. [score:1]
Based on all the available data to date, supplemented with our own results, TM8 function seems to have diversified quickly throughout angiosperms and acts as repressor of miR172 in Nicotiana benthamiana, together with NbSVP. [score:1]
Similar as for NbTM8, we identified NbSVP to function as a repressor of miR172. [score:1]
c Split petal tubes in NbTM8-VIGS and 35S: miR172 plants. [score:1]
a Extra floral organs in NbTM8- and NbSVP-VIGS plants, similar to the 35S: miR172 phenotype. [score:1]
We hypothesized that the first peak might be around the juvenile-adult transition, therefore we also quantified miR156 and miR172 levels by stem-loop qPCR (Fig. 2e). [score:1]
[1 to 20 of 26 sentences]
3
[+] score: 27
In contrast, miR172a and miR172b were downregulated by cold stress for 1 h in S. lycopersicum, while they upregulated in S. habrochaites by cold stress for 12 h. Fig. 5The total number of microRNAs (miRNAs) that were either cold -induced or cold-repressed in S. lycopersicum (C) and S. habrochaites (Tsh)We used psRNATarget (http://plantgrn. [score:9]
In contrast, miR172a and miR172b were downregulated by cold stress for 1 h in S. lycopersicum, while they upregulated in S. habrochaites by cold stress for 12 h. Fig. 5The total number of microRNAs (miRNAs) that were either cold -induced or cold-repressed in S. lycopersicum (C) and S. habrochaites (Tsh) We used psRNATarget (http://plantgrn. [score:9]
For example, the expression of miR172 was inhibited after cold stress at 1 h in S. lycopersicum, but was induced in S. habrochaites after cold stress at 12 h (Additional file 14). [score:5]
Additionally, miR172 was upregulated in A. thaliana [69] and B. distachyon [70]. [score:4]
[1 to 20 of 4 sentences]
4
[+] score: 25
For example, Moxon et al. (2008) found that one of the target genes of miR156 was CNR, which belongs to SBP-box family transcription factors (TFs), and the target gene of miR172 was AP2. [score:5]
For instance, AP2 is the target of miR172 and miR8737, miR319 and miR159 share the same target GAMYB. [score:5]
AP2 transcription factors, AP2-like ethylene-responsive transcription factors, ethylene-responsive transcription factor were TFs belong to AP2/EREBP transcription factors family involved in ethylene signaling pathway and they were the main targets of miR172 family, which was also reported in Arabidopsis and tomato (Wu et al., 2009; Cheng et al., 2016). [score:3]
Ethylene-responsive transcription factors were the target of miR172a, miR172b and the nat-siRNAs renamed as nat-siRNA-G2009, nat-siRNA-G2010, nat-siRNA-G2011, nat-siRNA-G2012, nat-siRNA-G2013, and nat-siRNA-G2014. [score:3]
As shown in Figure 6, it could clearly been seen that the AP2 TFs that involved in ethylene signaling were the targets of miR172a, miR172b, and miR8737. [score:3]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
From the network mo del, it could clearly been seen that miR394, miRZ131, miR172, miR8737, miR319, miR159, miR160, and nat-siRNA-G2001 to nat-siRNA-G2017 as well as their target genes such as auxin response factors, ethylene-responsive transcription factors and GAMYB were involved in ethylene signal pathway. [score:3]
[1 to 20 of 7 sentences]
5
[+] score: 24
In tomato degradome results, 15 target genes were related to stimulus response such as ARF and disease resistance proteins were identified in category 0 cleaved by sly‐miR160, sly‐miR168, sly‐miR172, sly‐miR396, sly‐miR482, sly‐miR6023 and sly‐miR6024 families (Figure  6, Table S4). [score:5]
Sly‐miR172 expression was decreased after drought treatment in rice (Zhou et al., 2010), barley (Hackenberg et al., 2015) and cotton (Xie et al., 2015), whereas up‐regulated in Arabidopsis (Jones‐Rhoades and Bartel, 2004), wheat (Kantar et al., 2011) and Populus (Ren et al., 2012). [score:4]
When the tomato plants were exposed to drought stress, miR172 family expressed significantly only in upground tissues of sensitive genotype and sly‐miR172a and sly‐miR172e‐3p were down‐regulated in response to drought by −2.01‐ and −1.07‐fold, respectively (Figure  3, Table S2). [score:4]
Additionally, sly‐miR393/miR6476 and sly‐miR172/miR5658 potentially targeted 5 and 4 related genes, respectively (Figure  11b). [score:3]
DELLA protein was targeted by 12 tomato miRNAs containing sly‐miR172, sly‐miR845, sly‐miR5641 and sly‐miR7696 (Figures  10 and 11b). [score:3]
Additionally, plant hormone signal transduction pathway genes were differentially regulated by miR169, miR172, miR393, miR5641, miR5658 and miR7997 in both tissues of both sensitive and tolerant genotypes. [score:2]
The results show that miR172 is different in response to drought among plant species and ABF gene is regulated by different miRNAs in different tissues and genotypes under drought stress. [score:2]
Likewise, sly‐miR169, sly‐miR172, sly‐miR393, sly‐miR5641, sly‐miR5658 and sly‐miR7997 function in plant hormone signal transduction pathway and related proteins (Figures  10 and 11b). [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 24
Alternatively, other miRNAs inhibit target gene expression through translational arrest, such as miR156 and miR172, which have been shown to regulate their target genes (SBPs and AP2) predominantly by inhibiting their translation [73- 76]. [score:16]
The majority of such targets are various transcriptional factors including SBP (miR156), MYB (miR159, miR319, miR172), NAM (miR164), and MADS-Box (miR396) that regulate plant development [53] or phytohormone signal transduction [54]. [score:5]
A few known miRNAs were expressed at high levels in fruit, such as miR157, miR162, miR164, miR166, miR168, miR172, miR396. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 21
For example, exogenous MeJA down-regulates miR156, miR168, miR169, miR172, miR172, miR396, miR480, and miR1310 and up-regulates miR164 and miR390 in Chinese yew (Qiu et al., 2009). [score:7]
In addition, a negative correlation between miRNA abundance and their targets was observed in Arabidopsis roots after infection with cyst nematode, leading to the down-regulation of miR156, miR159, miR172, and miR396 (Hewezi et al., 2008). [score:6]
The AP2-like ethylene-responsive transcription factor is the target of miR172 (Aukerman and Sakai, 2003; Chen et al., 2004; Schwab et al., 2005), and miR172a and AP2-like transcription factor gene (Solyc04g049800.2.1) expression showed a reverse pattern from 0h to 72h in leaf and from 24h to 72h in stem (Fig. 4J, K), and analogous patterns occurred in root (Fig. 4L). [score:5]
1, Solyc01g005730.2.1, Solyc01g005760.2.1, Solyc01g005780.1.1, Solyc01g005870.1.1, Solyc01g006550.2.1, Solyc01g009700.1.1, Solyc01g016370.1.1, Solyc03g082780.1.1, Solyc10g007210.1.1 novel_mir_906 8.50787391 Solyc07g018190.2.1, Solyc10g085120.1.1, Solyc12g044840.1.1 miR156 (Kasschau et al., 2003; Bazzini et al., 2007; Lu et al., 2007; Navarro et al., 2008; Xin et al., 2010; Zhang et al., 2011), miR159 (Subramanian et al., 2008; Xin et al., 2010; Zhang et al., 2011), miR172 (Subramanian et al., 2008; Wang et al., 2009; Zhang et al., 2011), miR396 (Hewezi et al., 2008, 2012; Navarro et al., 2008; Wang et al., 2009; Xin et al., 2010; Zhang et al., 2011), and miR319 (Subramanian et al., 2008; Zhang et al., 2011; Feng et al., 2014; Shen et al., 2014) have all been shown to respond to biotic stress in plants. [score:1]
High-throughput sequencing identified a range of miRNAs, such as miR156, miR159, miR172, miR319, miR393, and miR396, in response to Pseudomonas syringae (Zhang et al., 2011). [score:1]
Recently, a study of tomato infection by Cucumber mosaic virus (CMV) revealed 79 miRNAs and 40 predicted candidate miRNAs that were responsive to CMV infection, including miR156, miR159, miR172, miR319, mi393, and miR396 (Feng et al., 2014). [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 15
For instance, five (miR156e-3p, miR160a-3p, miR162a-5p, miR395a and miR398a-5p) and 19 (e. g., miR156b, miR156c, miR156e-3p, miR156e-5p, miR156d-5p, miR160a-3p, miR162a-5p) significantly expressed known miRNAs were specific to stamens in 2 d and 12 d libraries, respectively (Fig.   5a, Additional file 1: Table S6), whereas six significantly differentially expressed known miRNAs including miR172b, miR167a, miR319b, and miR482a were unique to pistils under heat-stress treatment for 12 d (Fig.   5a, Additional file 1: Table S7). [score:5]
Arabidopsis miR172 targets APETALA2-like genes and further regulates flowering time and floral organ identity [22]. [score:4]
Zhao L, Kim Y, Dinh TT, Chen X. miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. [score:4]
The majority of the 26 miRNA families contained more than one member, and miR156, miR171, miR172, miR319, miR396, and miR482 had more than seven members. [score:1]
A total of 36 miRNAs were identified in response to heat treatment (40 °C) for 2 h including miR172, miR156, and miR159 families in wheat [27, 28]. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 13
Most of the conserved miRNAs (such as miR156, miR159, miR160, miR164, miR167, miR171, miR172, miR319, and some others) usually target a range of transcription factors like MYBs, ARFs, SBPs, NACs, AP2-like factors, GRFs, and GRASs, and their miRNAs -mediated regulations are important for plant growth and development and may act in the core gene expression networks (Liu et al., 2013). [score:7]
Some miRNAs such as, miR156, miR162, miR164, miR166, miR172, miR397, and miR398 were reported to be highly conserved in tomato fruit and developmental stages (Zuo et al., 2012; Karlova et al., 2013). [score:2]
Graft-transmissible induction of potato tuberization by the microRNA miR172. [score:1]
Micro RNA families MIR156, MIR172, and MIR5303 contained highest five members while 11 families viz, MIR162, MIR166, MIR167, MIR168, MIR171, MIR1919, MIR319, MIR398, MIR482, MIR6024, and MIR7997 contained several members (2–4). [score:1]
However, recent evidence has indicated that only four miRNAs (miR399, miR395, miR172, and miR156) have been demonstrated as long-distance mobile signals in plants (Bhogale et al., 2014). [score:1]
In another study, miR172 was proposed as a long-distance mobile signal responsible for tuberization in potato (Solanum tuberosum) (Martin et al., 2009). [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 11
However, Arabidopsis miRNA172 regulates cell-fate specification as a translational repressor of APETALA2 [74] and miRNA156/157 inhibits translation of the SBP box gene, SPL3 [75]. [score:8]
In tomato (Solanum lycopersicum), the levels of miR319/miR159 and miR172 are induced during Tomato leaf curl New Delhi virus (ToLCNDV) disease progression [18]. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 7
A total of 29 DE genes were predicted targets of 11 tomato miRNAs (Table 2): four of them (miR156, miR159, miR171, miR172) were developmental miRNAs, conserved between plant families, and seven were family- (miR6022, miR6023, miR6024, miR6027, miR5303) or species-specific (miR1917, miR1918) miRNAs. [score:4]
Two transcripts (TC196115 and EG553974) coding for a receptor-like serine/threonine-protein kinase and an inositol-tetrakisphosphate 1-kinase 1, both induced by infection (FC = 3.21 and FC = 2.13 respectively), are targets of Sly-miR172, known to mediate the control of the flowering process [40]. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 7
Other miRNAs from this paper: sly-MIR160a, sly-MIR167a, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR399, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, sly-MIR168a, sly-MIR168b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR160a, ppe-MIR160b, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, sly-MIR156d, sly-MIR156e, sly-MIR167b, sly-MIR172c, sly-MIR172d, mdm-MIR399k, mdm-MIR172p
This number was soon increased to include miR168 (inhibiting ARGONAUTE1), miR172 (inhibiting APETALA2) (Itaya et al., 2008), and miR156 (targeting CNR) (Zhang et al., 2011). [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 7
Other miRNAs from this paper: sly-MIR172a, sly-MIR172c, sly-MIR172d
An interesting possibility that would require further studies is whether SlERF36 affects expression of homologues of TEMPRANILLO (TEM1 and TEM2) that are known to directly repress FT expression [31] or whether it in some way controls TOE1/TOE2 or miRNA172, the regulation of which affects flowering in both short and long day conditions [32]. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 6
For example, in our previous studies, overexpression of miR172 in tomato enhanced its susceptibility to P. infestans [13]. [score:3]
A number of plant miRNAs, such as miR159, miR160, miR166, miR169, miR172, and miR396, are involved in the response to drought, water deficit, and salt stresses 23, 24. [score:1]
Using high-throughput sequencing and homology -based computational research, we have previously identified a number of tomato miRNAs involved in tomato– P. infestans interaction including miR482, miR172, miR6024, miR6026, miR6027, etc. [score:1]
In rice, transgenic STTM lines silencing 35 miRNA families (miR398, miR172, miR156, etc. ) [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 6
MicroRNA172 (miRNA172) governs floral organ development and organ size by inhibiting translation of APETALA2 (AP2) (Yao et al., 2015). [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
In both phloem and leaflet samples, we found conserved miRNAs such as miR156 and miR172 known to act in concert to regulate flowering time (Spanudakis and Jackson, 2014) and miR159 previously identified in cucurbit phloem (Yoo et al., 2004). [score:2]
Accordingly, the plant-specific miR172 was detected in all leaf samples (Figure 3B) while the whitefly Bta_miR2A was detected in the nymph samples of B. tabaci reared on tomato and in the leaf samples containing eggs (LW and LE; Figure 3C). [score:1]
The plant specific sRNA miR172 was only found in leaf samples and not in the whitefly nymphs (Figure 3B) though this could have been possible since sRNAs have been found previously ingested by aphids (Sattar et al., 2012). [score:1]
Sample quality was further checked using a known B. tabaci specific sRNA (Bta_miR2A; Guo et al., 2013) and a known tomato miR172 that is conserved among land plants (Taylor et al., 2014). [score:1]
Sly-miR172, a very abundant tomato miRNAs present in our phloem sample could not be detected in our nymph sample while #3182 was found in the insect in a relative high level. [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, miRNA156, miRNA159 and miR172 targeted more than one gene family. [score:3]
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species. [score:1]
In the miR164, miR172 and miR395 families, all miRNA members were involved in duplication events. [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 5
Zhang et al., [29] reported that miR156, miR159, miR164, miR166, miR172 and miR319 were differentially expressed in sporogenous cell, MMCs and microspores between a male-sterile cotton and its maintainer line. [score:3]
There are increasing evidences showing that the function of miRNAs, including miR156, miR159, miR164, miR167, miR172 and miR319 is crucial during flower development and microsporogenesis [31– 33]. [score:2]
[1 to 20 of 2 sentences]
19
[+] score: 4
For example, SPL, AP2 and MADS-box, which were targeted by sha-miR156 (sha-miR156a, sha-miR156c, sha-miR156c_nta, sha-miR156d_nta, sha-miR156e_stu, sha-miR156g_stu, sha-miR156h_stu, sha-miR156i_stu and sha-miR156j_stu), sha-miR172 (sha-miR172a, sha-miR172b, sha-miR172i_nta and sha-miR172c-3p_aly) and sha-miR396a_nta, respectively, participated in plant development. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
Other miRNAs from this paper: sly-MIR172a, sly-MIR172c, sly-MIR172d
LEUNIG and SEUSS co-repressors regulate miR172 expression in Arabidopsis flowers. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 4
The target of miR172 is APETALA2 (AP2) (Karlova et al., 2013), which is a negative regulator of tomato fruit ripening (Chung et al., 2010; Karlova et al., 2011). [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR156b, mtr-MIR167a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR393b, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR156h, mtr-MIR166f, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, osa-MIR169r, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR397, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR172a, sly-MIR399, osa-MIR827, osa-MIR396f, mtr-MIR2118, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, mtr-MIR169k, mtr-MIR169j, mtr-MIR399q, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, mtr-MIR4414a, mtr-MIR4414b, mtr-MIR482, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, sly-MIR482e, sly-MIR482a, mtr-MIR167b, mtr-MIR168c, mtr-MIR408, mtr-MIR396c, mtr-MIR171g, stu-MIR6024, sly-MIR6024, stu-MIR482c, stu-MIR482b, stu-MIR482a, stu-MIR482d, stu-MIR482e, sly-MIR482b, sly-MIR482c, stu-MIR6025, stu-MIR6026, sly-MIR6026, sly-MIR168a, sly-MIR168b, mtr-MIR169i, mtr-MIR172d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, stu-MIR7980a, stu-MIR7983, stu-MIR8007a, stu-MIR8007b, stu-MIR7980b, stu-MIR399a, stu-MIR399b, stu-MIR399c, stu-MIR399d, stu-MIR399e, stu-MIR399f, stu-MIR399g, stu-MIR399h, stu-MIR3627, stu-MIR171b, stu-MIR166a, stu-MIR166b, stu-MIR166c, stu-MIR166d, stu-MIR171a, stu-MIR171c, stu-MIR399i, stu-MIR827, stu-MIR172b, stu-MIR172c, stu-MIR172a, stu-MIR172d, stu-MIR172e, stu-MIR156a, stu-MIR156b, stu-MIR156c, stu-MIR156d, stu-MIR171d, stu-MIR167c, stu-MIR167b, stu-MIR167a, stu-MIR167d, stu-MIR399j, stu-MIR399k, stu-MIR399l, stu-MIR399m, stu-MIR399n, stu-MIR399o, stu-MIR393, stu-MIR398a, stu-MIR398b, stu-MIR396, stu-MIR408a, stu-MIR408b, stu-MIR397, stu-MIR171e, stu-MIR156e, stu-MIR156f, stu-MIR156g, stu-MIR156h, stu-MIR156i, stu-MIR156j, stu-MIR156k, stu-MIR169a, stu-MIR169b, stu-MIR169c, stu-MIR169d, stu-MIR169e, stu-MIR169f, stu-MIR169g, stu-MIR169h, sly-MIR403, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR827, sly-MIR393, sly-MIR398a, sly-MIR399b, sly-MIR6025, sly-MIR169f, sly-MIR171f
micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules. [score:3]
Five miRNA families (miR399, miR156, miR166, miR171, and miR172) had more than 10 members, and miR156 family, the largest family, had 23 members. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 3
For instance, the expression of miRNA156, miRNA169, miRNA172 and miRNA319 was significantly changed upon drought stress in tomato, and these miRNAs were also induced by drought stress in Arabidopsis, rice and wheat [9, 29, 54, 55]. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Other miRNAs from this paper: sly-MIR172a, sly-MIR172c, sly-MIR172d
Mathieu, J., Yant, L. J., Murdter, F., Kuttner, F. and Schmid, M. (2009) Repression of flowering by the miR172 target SMZ. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
MiR156 promotes juvenile development, while miR172 promotes reproductive development. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Repression of flowering by the miR172 target SMZ. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 2
Several miRNA families, including miR157, miR159, miR162, miR164, miR167, miR171, miR172, miR390, miR396, and miR482, were moderately abundant (Figure  2A). [score:1]
Among the conserved miRNA families, 3 families (miR156, miR166, and miR172) consisted of more than 10 members. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 1
In addition, some miRNAs such as miR160, miR167, miRNA172, miR158, miR159, miR165/166, miR319, and miR393 are involved in pathogen defense [5, 7]. [score:1]
[1 to 20 of 1 sentences]