sort by

32 publications mentioning sly-MIR156b

Open access articles that are associated with the species Solanum lycopersicum and mention the gene name MIR156b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 93
For further analysis, targets were searched for instances where a miR156 target was found being targeted by other miRNAs too. [score:7]
Figure 7 shows a group of identified targets for miR156 and their corresponding inverse correlation scores while Table 4 details about the possible functions and identification of top fifty of these targets along-with their SVR scores. [score:5]
From this study, miR156 family emerged as an important miRNA in Oryza system, with largest number of targets (526 unique genes), many of which also scored high for negative expression correlation with miR156. [score:5]
Applying one of such cut-offs for inverse correlation for expression, we performed an analysis upon the top scoring targets for miR156, as demonstrated below. [score:5]
All the targets shown here scored inverse expression correlation with miR156, having absolute value of 0.8 or higher. [score:5]
Also, this needs to be mentioned that the mentioned number of target genes for miR156 is the gross number of targets for miR156 obtained with the parameters described in the beginning of this section. [score:5]
One of the possible reasoning for observing such high number of targets for miR156 could be attributed to existence of purine richness (GA/AG tract) in miR156 sequence, causing poly-pyrimidine regions to be counted as the targets due to complementarity. [score:5]
However, when p-TAREF was run with most liberal parameters to find the permuted miR156 targets, only 105 genes were found being targeted and with consideration of only miR156 specific encoded interaction pattern comparisons, absolutely no hit was found for the permuted miR156. [score:5]
Target identification in Rice transcriptome and emergence of miR156 as a prominent regulator. [score:4]
The same test was repeated with few more permuted miRNAs and almost similar pattern of lower number of random targets were observed, with absolutely no targets reported when miR156 specific encoded interaction patterns were considered. [score:4]
The present study found strong affinity of miR156 towards targeting genes involved in the process of transcription, growth and development which goes in sync with findings made previously with mentioned studies for miR156. [score:4]
For this part of the study, it can be seen that miR156 targeting was found significantly enriched for genes associated with process of transcription, nucleotide transfer process during transcription and catalytic activities. [score:3]
Table 5 shows the top 20 significantly enriched GO terms found associated with miR156 targets in Oryza sativa. [score:3]
Using p-TAREF, whole transcriptome level targets for rice transcriptome have been identified where miR156 was found as a critical miRNA in rice system. [score:3]
Therefore, these findings suggest a very limited possible role of repetitiveness/randomness in the observed abundance of miR156 targets. [score:3]
Figure 7 Graphical representation of targets of miR156 in rice transcriptome. [score:3]
Gene Ontology studies over the identified miR156 target genes and associated statistical testing for enrichment provided some interesting informations. [score:3]
When mapped for the target genes for miR156, only 56 genes were found common between these two sets of genes. [score:3]
The colored nodes are functional categories whose genes were found significantly enriched in the pool of miR156 targets. [score:3]
Previously done studies have reported critical role of miR156 in plant growth and developmental stage transitions like flowering, fruit ripening and shoot development, controlling some important transcription factors like SPL [35, 36]. [score:3]
The observation was made for enrichment of molecular functions found enriched and associated with targets of miR156. [score:3]
miR156 was found as an important component of the Rice regulatory system, where control of genes associated with growth and transcription looked predominant. [score:2]
Some recent studies now suggest that miR156 could be an eternal regulator of vegetative growth in plants and found critical in growth phase transitions [37]. [score:2]
Maintaining the constant dinucleotide composition, a permuted miR156 sequence was generated. [score:1]
For miR156 certain biological terms were found enriched. [score:1]
miR156-miR396 coexisted in 208 unique genes and 263 unique transcripts, showing enrichment for genes associated with molecular functions like Brassinosteriod-sulfotransferase activities (P-value: 4.9E-04), Fructokinase activities (P-value: 7.3E-04), Glucokinase activities (P-value: 7.3E-04) and UDP-gluco-4-aminobenzoate activities (p-value: 7.3E-04). [score:1]
miR156-miR160 coexisted in 110 unique genes and transcripts, enriched for molecular functions like RNA polymerase activity (P-value: 1.7E-03). [score:1]
miR156-miR166 coexisted in 25 unique genes and 36 unique transcripts, where genes associated with molecular functions like Beta-Galactosidase activity (P-value: 1.6E-03), were found enriched. [score:1]
[1 to 20 of 28 sentences]
2
[+] score: 58
We also observed a negative correlation in the expression patterns of miR156(i) and SBP at stage 3 based on qRT-PCR, in which miR156(i) was upregulated and SBP was downregulated. [score:9]
0175178.g005 Fig 5Using psRNAtarget Analysis server, conserved miRNAs including, miR164(i), miR171(i), miR159(i), miR394(i), miR156(i), miR482(ii), miR166(i), and miR168(i) were predicted to target genes including NAC, GRAS, GAMYB-like, Peroxiredoxin, SBP, Resistance protein, HB and AGO-1, respectively. [score:5]
The correlation in expression profile was deciphered between conserved miRNAs including, miR156(i), miR164(i), miR159(i), miR168(i) and miR396(i) and their target genes, SBP, NAC, GAMYB-like (MYB33 and MYB65), AGO1 and GRF1, respectively. [score:5]
Among the validated tomato miRNA targets, SBP, NAC, GAMYB-like, HB and GRAS transcription factors, targets of conserved miRNAs, miR156(i), miR164(i), miR159(i), miR166(i) and miR171(i), respectively were enriched under GO term, transcription factor activity. [score:5]
Using psRNAtarget Analysis server, conserved miRNAs including, miR164(i), miR171(i), miR159(i), miR394(i), miR156(i), miR482(ii), miR166(i), and miR168(i) were predicted to target genes including NAC, GRAS, GAMYB-like, Peroxiredoxin, SBP, Resistance protein, HB and AGO-1, respectively. [score:5]
Although, Zhao et al. [20] also reported an inverse correlation in expression profiles of miR156 and SBP, we report a negative correlation in expression between different member of miR156 and SBP family. [score:5]
0175178.g006 Fig 6The correlation in expression profile was deciphered between conserved miRNAs including, miR156(i), miR164(i), miR159(i), miR168(i) and miR396(i) and their target genes, SBP, NAC, GAMYB-like (MYB33 and MYB65), AGO1 and GRF1, respectively. [score:5]
In plants, miR156 family has several members that target different members of SPL/ SBP gene family and thereby modulate plant development, including, vegetative phase transition and embryo patterning. [score:4]
However, some of the conserved miRNAs including miR393(i), miR482(i), miR1446(i) and variant of miR156(i) and 4 novel miRNAs including Sly_miRNA667, Sly_miRNA996, Sly_miRNA1987 and Sly_miRNA2712 were also upregulated at stage 1 (invasion of J2s/ initiation of feeding sites). [score:4]
For example, known targets, SBP, NAC, GRAS, HB, GRF, GAMYB-like and TCP24 transcription factors were predicted for miR156(i), miR164(i), miR171(i), miR166(i), miR396(i), miR159(i) and miR319(i), respectively in our study. [score:3]
In our study, we have validated SBP transcription factor gene as a target of miR156 through 5’RLM-RACE. [score:3]
This suggests that several members of miR156 family may be involved in the regulation of different members of SPL/ SBP gene family during RKN pathogenesis in tomato. [score:2]
In tomato, out of 15 SBP genes, 10 possess binding sites for miR156 and miR157 [51– 53]. [score:1]
For example, miR164(i) and NAC transcription factor gene showed negative correlation at stages 3 and 5. While a negative correlation between miR156(i) and SBP was observed at stage 3 only (Fig 6). [score:1]
The sequencing results of cloned 5’RLM-RACE cleavage products revealed that cleavage site of SBP (Solyc05g015510.2) and peroxiredoxin (Solyc05g015520.2) lies between 9 [th] and 10 [th] base from 5’ end pairing of miR156(i) and miR394(i), respectively (Fig 5). [score:1]
[1 to 20 of 15 sentences]
3
[+] score: 58
Alternatively, other miRNAs inhibit target gene expression through translational arrest, such as miR156 and miR172, which have been shown to regulate their target genes (SBPs and AP2) predominantly by inhibiting their translation [73- 76]. [score:16]
Over -expression of miR156 can cause the fruit red colour slightly lighter than the wild type, which was thought that the expression of miR156 and CNR overlaps only partially and the function of the miRNA is to suppress CNR expression in specific cell types. [score:9]
The majority of such targets are various transcriptional factors including SBP (miR156), MYB (miR159, miR319, miR172), NAM (miR164), and MADS-Box (miR396) that regulate plant development [53] or phytohormone signal transduction [54]. [score:5]
Three miRNAs (miR394, miR414, miR1917) were down regulated; five miRNAs (miR156, miR159, miR396, miR482, miRZ7) were up regulated, while one miRNA (miR828) whose target is EIN2 was not affected, by exogenous ethylene treatment (Figure 9). [score:5]
Three miRNA families (miR394, miR414 and miR1917) were down regulated, in the contrary, four miRNA families (miR156, miR159, miR396, miR482 and miRZ7) were up-regulated, and however, the miR828 had no obvious change. [score:5]
MiR156 and miR394 were down regulated in the fruit ripening, miR159 showed down regulation in the breaker stage, while, miR396 showed a obvious increase in the breaker stage, miR828 and miR1917 were down regulated in the red ripe stage, miR482 and miRZ7 showed down regulation in the red and softening ripe stage. [score:5]
The expression levels of miR156 also decreased during fruit ripening (Table 2 and Figure 8). [score:3]
A target gene of miR156 belong to squamosa-promoter binding protein (SBP) family called CNR was validated, which plays pivotal roles in fruit ripening [57]. [score:3]
Colorless non-ripening (CNR), a member of the squamosa-promoter binding protein (SBP) family that was shown to be involved in fruit ripening [58], is targeted by miR156 [31, 39]. [score:3]
Several conserved and non-conserved miRNAs were identified in this study, and miR156 was found to be involved in fruit ripening which raised the possibility that fruit ripening process may be under miRNA regulation [26] Tomato fruit ripening and senescence are genetically regulated processes. [score:3]
The members of each family were different, the miR156, miR166 and miR171 had more than ten members, in the contrary, miR160, miR319, miR394, miR395, miR399, miR408, miR472, miR482, miR827 had only one member in their corresponding family. [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 41
For instance, five (miR156e-3p, miR160a-3p, miR162a-5p, miR395a and miR398a-5p) and 19 (e. g., miR156b, miR156c, miR156e-3p, miR156e-5p, miR156d-5p, miR160a-3p, miR162a-5p) significantly expressed known miRNAs were specific to stamens in 2 d and 12 d libraries, respectively (Fig.   5a, Additional file 1: Table S6), whereas six significantly differentially expressed known miRNAs including miR172b, miR167a, miR319b, and miR482a were unique to pistils under heat-stress treatment for 12 d (Fig.   5a, Additional file 1: Table S7). [score:5]
Thus, the expression profiles of five target genes, SlSPL15 for miR156, SlARF10 and SlARF16 for miR160, SlTIR1 for miR393, and SlCSD1 for miR398, were analyzed in stamens and pistils. [score:5]
A series of SPL TFs are targeted by the miR156 family, and the miR156/SPL module emerges as a pivotal regulator covering multiple aspects of plants, including the timing of phase changes, leaf development, organ size, fertility, and responses to stresses [69]. [score:5]
Our sequencing data showed that five miR156 family members were significantly downregulated under heat-stress treatment (Additional file 1: Table S2). [score:4]
microRNA156 -targeted SPL/SBP box transcription factors regulate tomato ovary and fruit development. [score:4]
These results imply that the miR156/SPL module might function in the regulation of stamen development under heat-stress conditions. [score:3]
Wang JW, Schwab R, Czech B, Mica E, Weigel D. Dual effects of miR156 -targeted SPL genes and CYP78A5/KLUH on plastochron length and organ size in Arabidopsis thaliana. [score:3]
In Arabidopsis, overexpression of miR156b results in serious defects in juvenile-to-adult phase transitions and inflorescence architecture via the strong repression of SPL9 and SPL15 [70]. [score:3]
Wang J. Regulation of flowering time by the miR156 -mediated age pathway. [score:2]
MicroRNA156b plays a critical role in the control of flower and fruit morphology in tomato through the regulation of meristem maintenance and the initial stage of fruit development [23]. [score:2]
Wang JW, Czech B, Weigel D. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. [score:2]
A total of 36 miRNAs were identified in response to heat treatment (40 °C) for 2 h including miR172, miR156, and miR159 families in wheat [27, 28]. [score:1]
Some miRNAs (e. g., miR156, miR164, miR168, miR171, miR393, miR396, and miR398) are associated with a broad range of plant defense responses to stresses including drought, salt, and cold stresses [18]. [score:1]
The majority of the 26 miRNA families contained more than one member, and miR156, miR171, miR172, miR319, miR396, and miR482 had more than seven members. [score:1]
[1 to 20 of 14 sentences]
5
[+] score: 30
In this study, we found that miR156 and miR396 were up-regulated and miR168 was down-regulated in the heat-tolerant wild tomato at the moderately elevated temperature. [score:7]
In our previous research, we found that miR156, miR319, miR396 and miR398 were up-regulated and miR168 was down-regulated in a wild chill-tolerant tomato at low temperature 25. [score:7]
Therefore, both the low temperature and the moderately elevated temperature induced the expression of miR156 and miR396 and inhibited the expression of miR168 in the tomato plants. [score:7]
These results indicate that expression of miR156 and miR167 in tomato plants is induced not only by exposure to acutely elevated temperatures (≥40 °C) but also by exposure to moderately elevated temperatures that were slightly higher than the optimum temperature for plant growth. [score:3]
By comparison, spi-miR167a was significantly up-regulated (1.05-fold) and spi-miR156b-p3 was detected only in the library from the plants held at 40 °C compared to the control library (Supplementary Table S3). [score:3]
We found that some miRNAs (including miR156, miR167 and miR168) in tomato plants might respond when the plants are exposed to temperatures only slightly higher than the normal growing temperature, while others (miR160, miR398 and miR399) might only respond to acutely elevated temperatures. [score:1]
Of the 71 families, miR166 was the largest, with 27 miRNA members, followed by miR159, miR8007 and miR156, with 23, 23 and 21 miRNA members, respectively (Fig. 3). [score:1]
For example, miR156 and miR167 were induced in Triticum aestivum and Brassica rapa by exposure to high temperatures (40 °C and 46 °C, respectively) 26 37. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 22
Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. [score:5]
Gradual increase of miR156 regulates temporal expression changes of numerous genes during leaf development in rice. [score:5]
Overexpression of miR156 in switchgrass (Panicum virgatum L. ) results in various morphological alterations and leads to improved biomass production. [score:3]
MiR156 promotes juvenile development, while miR172 promotes reproductive development. [score:3]
Intriguingly, tsh4 is targeted by miR156, which as mentioned above plays a fundamental role in the juvenile to adult transition. [score:3]
For example, the dominant maize mutant Corngrass1 (Cg1) overexpresses miR156 and extends the juvenile phase. [score:3]
[1 to 20 of 6 sentences]
7
[+] score: 19
For example, exogenous MeJA down-regulates miR156, miR168, miR169, miR172, miR172, miR396, miR480, and miR1310 and up-regulates miR164 and miR390 in Chinese yew (Qiu et al., 2009). [score:7]
In addition, a negative correlation between miRNA abundance and their targets was observed in Arabidopsis roots after infection with cyst nematode, leading to the down-regulation of miR156, miR159, miR172, and miR396 (Hewezi et al., 2008). [score:6]
The squamosa promoter -binding protein gene (Solyc10g078700.1.1, SPL) is the target of miR156 (Lu et al., 2005, 2008; Bazzini et al., 2007). [score:3]
1, Solyc01g005730.2.1, Solyc01g005760.2.1, Solyc01g005780.1.1, Solyc01g005870.1.1, Solyc01g006550.2.1, Solyc01g009700.1.1, Solyc01g016370.1.1, Solyc03g082780.1.1, Solyc10g007210.1.1 novel_mir_906 8.50787391 Solyc07g018190.2.1, Solyc10g085120.1.1, Solyc12g044840.1.1 miR156 (Kasschau et al., 2003; Bazzini et al., 2007; Lu et al., 2007; Navarro et al., 2008; Xin et al., 2010; Zhang et al., 2011), miR159 (Subramanian et al., 2008; Xin et al., 2010; Zhang et al., 2011), miR172 (Subramanian et al., 2008; Wang et al., 2009; Zhang et al., 2011), miR396 (Hewezi et al., 2008, 2012; Navarro et al., 2008; Wang et al., 2009; Xin et al., 2010; Zhang et al., 2011), and miR319 (Subramanian et al., 2008; Zhang et al., 2011; Feng et al., 2014; Shen et al., 2014) have all been shown to respond to biotic stress in plants. [score:1]
Recently, a study of tomato infection by Cucumber mosaic virus (CMV) revealed 79 miRNAs and 40 predicted candidate miRNAs that were responsive to CMV infection, including miR156, miR159, miR172, miR319, mi393, and miR396 (Feng et al., 2014). [score:1]
High-throughput sequencing identified a range of miRNAs, such as miR156, miR159, miR172, miR319, miR393, and miR396, in response to Pseudomonas syringae (Zhang et al., 2011). [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 19
Transcript AK247958, coding for a SQUAMOSA promoter binding protein 6b and target of the conserved Sly-miR156, was up-regulated (FC = 1.4) in infected tissues; searching among the tomato degradome sequences, available at the SoMART website [35], we identified 5′-uncapped remnants of polyadenylated mRNAs mapping at the predicted cleavage site, thus confirming the target prediction (data not shown). [score:8]
A second transcript coding for an unknown protein (AK329145) was also predicted to be a target of Sly-miR156, although with lower complementarity between the miRNA and the target sequence and lower target accessibility. [score:7]
A total of 29 DE genes were predicted targets of 11 tomato miRNAs (Table 2): four of them (miR156, miR159, miR171, miR172) were developmental miRNAs, conserved between plant families, and seven were family- (miR6022, miR6023, miR6024, miR6027, miR5303) or species-specific (miR1917, miR1918) miRNAs. [score:4]
[1 to 20 of 3 sentences]
9
[+] score: 18
miR160 and miR5300, were downregulated; however, no significant differential expression in B. cinerea-inoculated leaves was observed for miR156 (Figure  5). [score:6]
A few conserved miRNA families such as miR156, miR166, and miR168 showed high expression levels (more than 10,000 RPM) in both the libraries. [score:3]
The most abundantly expressed miRNA family was miR156 with 39,076 (TC7d) and 85,295 (TD7d) RPM, accounting for 43.2% and 62.2% of all the conserved miRNA reads, respectively. [score:3]
We examined the expression patterns by subjecting 9 B. cinerea-responsive miRNAs, including 8 known miRNAs (miR156, miR159, miR160, miR169, miR319, miR394, miR1919, and miR5300) and 1 novel miRNA (miRn1), to quantitative reverse-transcription PCR (qRT-PCR) (Figure  5). [score:3]
Therefore, these miRNAs, except for miR156, may be involved in the response to B. cinerea infection in tomato leaves. [score:1]
Among the conserved miRNA families, 3 families (miR156, miR166, and miR172) consisted of more than 10 members. [score:1]
For instance, the abundance of miR156 members varied from 0 to 923,832 reads. [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 18
For example, miR156 targets SBP transcription factors, but sly‐miR156d‐3p targeted NAD(H)‐like kinase protein, while sly‐miR156e‐5p targeted four genes including SBP6 and PSII protein. [score:7]
In our study, we found 44 target genes, but only the targets of 4 miRNAs (sly‐miR156, sly‐miR160, sly‐miR166 and sly‐miR482) were matched with their results (Table S4). [score:5]
These targets were cleaved by sly‐miR156, sly‐miR164, sly‐miR166, sly‐miR169, sly‐miR171, sly‐miR395 and sly‐mir9477 (Table S4). [score:3]
Eleven miRNA families (sly‐miR156, sly‐miR157, sly‐miR164, sly‐miR166, sly‐miR167, sly‐miR168, sly‐miR4414, sly‐miR6022, sly‐miR6027, sly‐miR7822 and sly‐miR9471) were represented with the top read abundance above 10 000 at all libraries (Table S2). [score:1]
Other two stress‐related genes, SBP and ARF, were cleaved by sly‐miR156 and sly‐miR160 families, respectively. [score:1]
In category 1, only two genes cleaved by miR156 and miR162 families were obtained (Table S4). [score:1]
[1 to 20 of 6 sentences]
11
[+] score: 14
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
However, miRNA156, miRNA159 and miR172 targeted more than one gene family. [score:3]
Figure S1 Blast2 alignments for pre-miRNA sequences of pda-miR156a, pda-miR156b and pda-miR156g. [score:1]
Alignment of multiple sequences and phylogenic analysis of microRNA156 pre-miRNAs in date palm. [score:1]
B) Phylogenic tree (formed by Neighbor Joining) for miRNA in the miR156 family. [score:1]
0071435.g003 Figure 3 A) Alignment of twelve pre-miRNA sequences of miR156. [score:1]
Within the miR156 family, sequence alignments showed that miR156e/j, miR156f/i, miR156a/g, miR156c/h, and miR156k/l had high similarity, and the 12 miRNAs could be divided into five groups based on multiple sequence alignments (Figure 3A–B and Figure S1). [score:1]
A) Alignment of twelve pre-miRNA sequences of miR156. [score:1]
As shown in Table 1, the most abundant miRNA family was miR156/157 (12 loci), which has been identified in 45 plant species and which had an average copy number about 18 in the seven other well-studied plant genomes analyzed (Table S2). [score:1]
C) Blast2 results for two pairs of paralogous date palm contigs containing pre-miR156. [score:1]
Further sequence comparison between date palm contigs containing miR156 showed that four pairs of miRNAs (miR156e/j, miR156f/i, miR156a/g, and miR156c/h) had highly similar flanking sequences (Table 2). [score:1]
These thirteen conserved pre-miRNAs belonged to the miR156 (6), miR159 (4), miR160 (2) and miR170 (1) families. [score:1]
These duplicated regions included miRNAs from all 21 families, and duplication on family miR156 duplicated was detected in all four species. [score:1]
[1 to 20 of 12 sentences]
12
[+] score: 13
e Relative expression of miR156 (left) and miR172 (right) during Nicotiana development. [score:4]
In agreement with this hypothesis we found that the first peak in NbTM8 expression coincides almost perfectly with the moment that miR156 drops below the increasing miR172 level. [score:3]
To examine the expression of selected genes and microRNA’s (NbTM8, NbSVP, NbSOC1, NbAP1, miR156 and miR172), qRT-PCR was used. [score:3]
These observations suggest that NbTM8 acts during both phase transitions in Nicotiana, possibly by regulating miR156 and miR172. [score:2]
We hypothesized that the first peak might be around the juvenile-adult transition, therefore we also quantified miR156 and miR172 levels by stem-loop qPCR (Fig. 2e). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 12
However, Arabidopsis miRNA172 regulates cell-fate specification as a translational repressor of APETALA2 [74] and miRNA156/157 inhibits translation of the SBP box gene, SPL3 [75]. [score:8]
org): miR156, miR156c, miR156kj and miR157d: Squamosa-promoter Binding Protein (SBP)-like transcription factors; miR166glmf: HD-Zip transcription factors, including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development; miR167b, miR167d and miR167fijeghac: Auxin Response Factors (ARF transcription factors); miR396abcd: Growth Regulating Factor (GRF) transcription factors, rhodenase-like proteins, and kinesin-like protein B; miR394ab, F-box proteins; miR827abc: Unknown; miR403bdf: Virus defense; miR162 and miR162abc: Unknown; miR530: Unknown; miR398abc: copper superoxide dismutases and cytochrome C oxidase subunit V; miR482f: NB domain proteins; miR5300, Unknown. [score:4]
[1 to 20 of 2 sentences]
14
[+] score: 12
Most of the conserved miRNAs (such as miR156, miR159, miR160, miR164, miR167, miR171, miR172, miR319, and some others) usually target a range of transcription factors like MYBs, ARFs, SBPs, NACs, AP2-like factors, GRFs, and GRASs, and their miRNAs -mediated regulations are important for plant growth and development and may act in the core gene expression networks (Liu et al., 2013). [score:7]
Some miRNAs such as, miR156, miR162, miR164, miR166, miR172, miR397, and miR398 were reported to be highly conserved in tomato fruit and developmental stages (Zuo et al., 2012; Karlova et al., 2013). [score:2]
A recent report by Bhogale et al. confirmed miR156 as a graft-transmissible miRNA which modulated potato plant architecture and tuberization in a potato micro-grafting method (Bhogale et al., 2014). [score:1]
Micro RNA families MIR156, MIR172, and MIR5303 contained highest five members while 11 families viz, MIR162, MIR166, MIR167, MIR168, MIR171, MIR1919, MIR319, MIR398, MIR482, MIR6024, and MIR7997 contained several members (2–4). [score:1]
However, recent evidence has indicated that only four miRNAs (miR399, miR395, miR172, and miR156) have been demonstrated as long-distance mobile signals in plants (Bhogale et al., 2014). [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 10
By elucidating the network between miRNAs and their target genes (Figure  6), the increased sha-miR156 (sha-miR156a, sha-miR156c, sha-miR156c_nta, sha-miR156d_nta, sha-miR156e_stu, sha-miR156g_stu, sha-miR156h_stu, sha-miR156i_stu, sha-miR156j_stu and sha-miR156i-p3_nta), sha-miR171b-3p_stu, sha-miR319b_stu, sha-miR396 (sha-miR396a_nta, sha-miR396b_nta and sha-miR396c_nta) and sha-miR398_nta targeted genes with various functions, which suggested that these miRNAs played important regulatory roles in the tomato chilling response network. [score:6]
For example, SPL, AP2 and MADS-box, which were targeted by sha-miR156 (sha-miR156a, sha-miR156c, sha-miR156c_nta, sha-miR156d_nta, sha-miR156e_stu, sha-miR156g_stu, sha-miR156h_stu, sha-miR156i_stu and sha-miR156j_stu), sha-miR172 (sha-miR172a, sha-miR172b, sha-miR172i_nta and sha-miR172c-3p_aly) and sha-miR396a_nta, respectively, participated in plant development. [score:4]
[1 to 20 of 2 sentences]
16
[+] score: 9
Overexpressing miRNA156 in Arabidopsis and rice results in reduced expression of SPL genes, and further affects the downstream genes PAP1 and DRF that function in anthocyanin pathway. [score:5]
For instance, the expression of miRNA156, miRNA169, miRNA172 and miRNA319 was significantly changed upon drought stress in tomato, and these miRNAs were also induced by drought stress in Arabidopsis, rice and wheat [9, 29, 54, 55]. [score:3]
The numbers of miRNAs varied in different miRNA families, with the most members (seven) in sly-miR156 and sly-miR482, followed with five miRNAs in the family of sly-miR171. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 9
For example, Moxon et al. (2008) found that one of the target genes of miR156 was CNR, which belongs to SBP-box family transcription factors (TFs), and the target gene of miR172 was AP2. [score:5]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
For instance, miR156 and miR482 were the largest ones with seven members in the families in this study. [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 8
Fu C Sunkar R Zhou C Overexpression of miR156 in switchgrass. [score:3]
Zhang et al., [29] reported that miR156, miR159, miR164, miR166, miR172 and miR319 were differentially expressed in sporogenous cell, MMCs and microspores between a male-sterile cotton and its maintainer line. [score:3]
There are increasing evidences showing that the function of miRNAs, including miR156, miR159, miR164, miR167, miR172 and miR319 is crucial during flower development and microsporogenesis [31– 33]. [score:2]
[1 to 20 of 3 sentences]
19
[+] score: 7
In Arabidopsis, the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factors SPL9 and SPL15 act redundantly to influence plastochron and over -expression of miR156, which targets multiple SPLs, shortens plastochron [18]. [score:5]
Analogous to the relationship of the plastochron 1 and 2 loci of rice [17], the SPL/miR156 regulatory module acts independently of CYP78A5/KLUH, which is a putative ortholog of rice plastochron 1 [18]. [score:2]
[1 to 20 of 2 sentences]
20
[+] score: 7
Other miRNAs from this paper: sly-MIR160a, sly-MIR167a, sly-MIR156a, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, sly-MIR168a, sly-MIR168b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR160a, ppe-MIR160b, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR168, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR399a, ppe-MIR399b, ppe-MIR399c, ppe-MIR399d, ppe-MIR399e, ppe-MIR399f, ppe-MIR399g, ppe-MIR399h, ppe-MIR399i, ppe-MIR399j, ppe-MIR399k, ppe-MIR399l, ppe-MIR399m, ppe-MIR399n, sly-MIR156d, sly-MIR156e, sly-MIR167b, sly-MIR172c, sly-MIR172d, mdm-MIR399k, mdm-MIR172p
This number was soon increased to include miR168 (inhibiting ARGONAUTE1), miR172 (inhibiting APETALA2) (Itaya et al., 2008), and miR156 (targeting CNR) (Zhang et al., 2011). [score:7]
[1 to 20 of 1 sentences]
21
[+] score: 6
In a recent study, its role in conferring resistance to insects in young plants of Arabidopsis has been demonstrated, and is regulated by miR156 -targeted-SPL9 (negatively correlated with JA expression) (Mao et al., 2017). [score:6]
[1 to 20 of 1 sentences]
22
[+] score: 6
For example, the target of miR156/157 is Colorless Non-Ripening (CNR) (Karlova et al., 2013), an epigenetic mutation of which could inhibit tomato fruit ripening (Manning et al., 2006). [score:6]
[1 to 20 of 1 sentences]
23
[+] score: 5
miR171‐GRAS module controls flowering time (phase transition) and trichome distribution via inhibiting the activity of miR156‐targeted SPL proteins (Xue et al., 2014). [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 4
For instance, miR6024-3p, miR5658, miR5139, sly-miR156, novel_mir_156, and novel_mir_447 had 71, 45, 15, 11, 6 and 2 predicted target genes, respectively. [score:3]
Among known miRNAs, five members including sly-miR156, miR167a, miR168a, miR166g-3p, and sly-miR166, showed high abundance with >5000 standardized reads (Transcripts per millions, TPM). [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 4
Other miRNAs from this paper: sly-MIR156a, sly-MIR156c, sly-MIR156d, sly-MIR156e
Detection of amplification products derived from stem loop pulsed RT-PCR for potential siRNA derived from target genes (V-ATPase or AK, both 60 bp), plus the microRNA156 (MIR156; 60 bp) control ran at 3% agarose gel electrophoresis. [score:3]
Gene-specific and the universal primer sequences used to detect the predicted small interfering RNAs (siRNA) derived from the target genes V-ATPase (siRNA AATACATGCGCGCTCTAGATGAC) and AK (siRNA AAGTATCGTCCACACTGTCTGGC) and the control microRNA156 (UGACAGAAGAGAGUGAGCAC) in transgenic plants. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 3
One possibility is that the increased accumulation of miR156 led to a decrease in the expression of SBP that influenced fruit weight, which was confirmed in transgenic tomato plants [37]. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
Dual effects of miR156 -targeted SPL genes and CYP78A5/KLUH on plastochron length and organ size in Arabidopsis thaliana. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
The mobile florigen also rescued the size and structure of defective abscission zones in the floral pedicles of mutant macrocalix and blind plants (Figure 3; Shalit et al., 2009), and the normal flowering pattern in miR156 -overexpressing plants (unpublished). [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 2
In both phloem and leaflet samples, we found conserved miRNAs such as miR156 and miR172 known to act in concert to regulate flowering time (Spanudakis and Jackson, 2014) and miR159 previously identified in cucurbit phloem (Yoo et al., 2004). [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR396e, mtr-MIR166a, mtr-MIR169a, mtr-MIR399b, mtr-MIR399d, mtr-MIR393a, mtr-MIR399c, mtr-MIR399a, mtr-MIR399e, mtr-MIR156a, mtr-MIR171a, mtr-MIR156b, mtr-MIR167a, mtr-MIR166b, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR171b, mtr-MIR166c, mtr-MIR166d, mtr-MIR169f, mtr-MIR156c, mtr-MIR156d, mtr-MIR399f, mtr-MIR399g, mtr-MIR399h, mtr-MIR399i, mtr-MIR399j, mtr-MIR399k, mtr-MIR166e, mtr-MIR156e, mtr-MIR171c, mtr-MIR398a, mtr-MIR172a, mtr-MIR393b, mtr-MIR398b, mtr-MIR168a, mtr-MIR169g, mtr-MIR156f, mtr-MIR399l, mtr-MIR156g, mtr-MIR399m, mtr-MIR399n, mtr-MIR399o, mtr-MIR398c, mtr-MIR156h, mtr-MIR166f, mtr-MIR166g, mtr-MIR171d, mtr-MIR171e, mtr-MIR396a, mtr-MIR396b, mtr-MIR169h, mtr-MIR169b, mtr-MIR156i, mtr-MIR171f, mtr-MIR399p, osa-MIR169r, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR397, sly-MIR156a, sly-MIR156c, sly-MIR172a, sly-MIR172b, sly-MIR399, osa-MIR827, osa-MIR396f, mtr-MIR2118, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, mtr-MIR169k, mtr-MIR169j, mtr-MIR399q, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR5072, mtr-MIR4414a, mtr-MIR4414b, mtr-MIR482, mtr-MIR172b, mtr-MIR172c, mtr-MIR171h, mtr-MIR168b, mtr-MIR399r, mtr-MIR156j, sly-MIR482e, sly-MIR482a, mtr-MIR167b, mtr-MIR168c, mtr-MIR408, mtr-MIR396c, mtr-MIR171g, stu-MIR6024, sly-MIR6024, stu-MIR482c, stu-MIR482b, stu-MIR482a, stu-MIR482d, stu-MIR482e, sly-MIR482b, sly-MIR482c, stu-MIR6025, stu-MIR6026, sly-MIR6026, sly-MIR168a, sly-MIR168b, mtr-MIR169i, mtr-MIR172d, mtr-MIR397, mtr-MIR169l, mtr-MIR399s, mtr-MIR399t, stu-MIR7980a, stu-MIR7983, stu-MIR8007a, stu-MIR8007b, stu-MIR7980b, stu-MIR399a, stu-MIR399b, stu-MIR399c, stu-MIR399d, stu-MIR399e, stu-MIR399f, stu-MIR399g, stu-MIR399h, stu-MIR3627, stu-MIR171b, stu-MIR166a, stu-MIR166b, stu-MIR166c, stu-MIR166d, stu-MIR171a, stu-MIR171c, stu-MIR399i, stu-MIR827, stu-MIR172b, stu-MIR172c, stu-MIR172a, stu-MIR172d, stu-MIR172e, stu-MIR156a, stu-MIR156b, stu-MIR156c, stu-MIR156d, stu-MIR171d, stu-MIR167c, stu-MIR167b, stu-MIR167a, stu-MIR167d, stu-MIR399j, stu-MIR399k, stu-MIR399l, stu-MIR399m, stu-MIR399n, stu-MIR399o, stu-MIR393, stu-MIR398a, stu-MIR398b, stu-MIR396, stu-MIR408a, stu-MIR408b, stu-MIR397, stu-MIR171e, stu-MIR156e, stu-MIR156f, stu-MIR156g, stu-MIR156h, stu-MIR156i, stu-MIR156j, stu-MIR156k, stu-MIR169a, stu-MIR169b, stu-MIR169c, stu-MIR169d, stu-MIR169e, stu-MIR169f, stu-MIR169g, stu-MIR169h, sly-MIR403, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR827, sly-MIR393, sly-MIR398a, sly-MIR399b, sly-MIR6025, sly-MIR169f, sly-MIR171f
The reads number for these known miRNAs also varied to a large extent ranging from 1 to 363294, with miR166, miR156, and miR168 families having the most abundant reads in the two libraries. [score:1]
Five miRNA families (miR399, miR156, miR166, miR171, and miR172) had more than 10 members, and miR156 family, the largest family, had 23 members. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 1
In rice, transgenic STTM lines silencing 35 miRNA families (miR398, miR172, miR156, etc. ) [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
miR156 and the abovementioned miR166 exhibited no visible changes. [score:1]
[1 to 20 of 1 sentences]