miRNA Search Results

sort by 2 publications mentioning mmu-mir-1971 Open access articles that are associated with the species Mus musculus and mention the gene name mir-1971. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.
1	[+] score: 81 Other miRNAs from this paper: mmu-mir-195a, mmu-let-7d, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-100, mmu-mir-33, mmu-mir-1947, mmu-mir-195b Then, we used computational methods to predict potential target genes of mmu-miR-1971: we applied TargetScanMouse 6.2 [4] (53) and MirTarget2 [5] (54, 55); we included only those predicted target genes that were identified with both approaches into subsequent GO analysis by employing GenericGeneOntologyTermFinder [6] (56) and REViGO [7] (57) (Table 2). [score:9] Taken together, target prediction and GO analyses revealed several predicted target genes of mmu-miR-1971 and several validated target genes mmu-miR-33-5p which might possibly be involved inter alia in PTSD pathobiology or fluoxetine -mediated alterations of molecular pathways. [score:7] Finally, to get an idea of the potential role of mmu-miR-1971 and mmu-miR-33-5p in PTSD and of their general function, we performed an in silico analysis of target genes regulated by these two miRNA candidates: analysis performed with the miRWalk database [3] (52) revealed several validated target genes of mmu-miR-33-5p (Table 3), but none of mmu-miR-1971. [score:6] However, GO analysis of predicted miR-1971 target genes allude that this above-average small (18nt) miRNA candidate might be involved inter alia in basic metabolic processes like heterocycle and organic substance metabolism (Table 2: p = 2.27E−06 and p = 3.73E−05, respectively); neurotransmitters like serotonin or modulators of the serotonergic tone might belong to the organic substances whose metabolism is targeted by miR-1971, but, however, our GO analysis provided no direct hint for this speculation. [score:6] Our miRNA target prediction and GO analysis revealed that for miR-1971 no target genes have been validated so far (Table 2). [score:5] Instead, in the only study reporting expression level changes of miR-1971 demonstrated that, in the bone marrow, miR-1971 was differentially expressed between patients suffering from acute lymphoblastic leukemia (ALL) and healthy donors (59). [score:5] Here, we present the first study exploring miRNA expression profiles in a. In summary, we demonstrate that the therapeutic action of fluoxetine in shocked mice (Figure 1) is correlated with a significant reduction in prefrontal cortical mmu-miR-1971 expression levels on day 74 after shock exposure (Figures 1 and 5A). [score:5] Taken together, microarray analyses revealed that, in shocked mice, on day 74 after subjection of mice to footshock, the therapeutic effect of fluoxetine (Figure 1) went along with a significant decrease in prefrontal cortical rno-miR-3559-3p and mmu-miR-1971 expression as well as with a trend of reduction in prefrontal cortical ebv-miR-BART8-3p and mmu-miR-1947-3p expression (Figure 3A). [score:5] The molecular functions of predicted mmu-miR-1971 target genes are mainly associated with small molecule and nucleic acid binding (Table 2). [score:3] Interestingly, we found that traumatic stress per se and fluoxetine treatment per se did not lead to significant alterations of mouse miRNA profiles on day 74 after trauma exposure (Figures 2 and 4) which suggests that fluoxetine interacts with traumatic stress to alter expression levels of mmu-miR-1971 and mmu-miR-33-5p (Figures 5A,C). [score:3] Figure 5 RT-qPCR analysis confirmed that fluoxetine treatment alters the expression of mmu-miR-1971 and mmu-miR-33-5 in the PFC of shocked mice. [score:3] Most important, we observed a statistically significant reduction in mmu-miR-1971 expression in the PFC of shock-fluoxetine mice in comparison to shock-vehicle mice (Figure 5A: Bonferroni posttest of shock-vehicle versus shock-fluoxetine: t = 2.509, p < 0.050). [score:3] In summary, the most important conclusion of this study is that in the studied here, the therapeutic action of fluoxetine (Figure 1) is accompanied by a significant reduction in prefrontal cortical mmu-miR-1971 expression on day 74 after shock exposure (Figures 3A and 5B). [score:3] RT-qPCR data do not allow the conclusion that fluoxetine rescues the footshock -induced increase in mmu-miR-1971 expression, since the latter failed to survive correction for multiple testing (Figure 5A). [score:3] RT-qPCR data do not allow the conclusion that fluoxetine rescues the footshock -induced increase in mmu-miR-1971 expression, since the latter failed to survive statistical correction (Figure 5A). [score:3] RT-qPCR analysis confirmed that fluoxetine treatment alters the expression of mmu-miR-1971 and mmu-miR-33-5p in the PFC of shocked mice. [score:3] Hence, regulation and function of miR-1971 are largely unexplored yet and await further studies. [score:2] Depicted are results of the RT-qPCR analysis of the relative expression levels of the candidate microRNAs mmu-miR-1971 (A), mmu-miR-1947-3p (B), and mmu-miR-33-5p (C) compared between the no-shock-vehicle, no-shock-fluoxetine, shock-vehicle, and shock-fluoxetine groups (n = 6 per group). [score:2] /design ID (custom) Target miRNA sequence mmu-miR-33-5p 204632 GUGCAUUGUAGUUGCAUUGCA mmu-miR-100-5p 204133 AACCCGUAGAUCCGAACUUGUG mmu-miR-1971 206999 (custom)/design ID 212160 GUAAAGGCUGGGCUGAGA mmu-miR-1947-3p 206999 (custom)/design ID 212154 GCACUGAGCUAGCUCUCCCUCC rno-miR-3559-3p 206999 (custom)/design ID 212147 AUGUAGUACUGAGUCUGUCGUG ebv-miR-BART8-3p 206999 (custom)/design ID 212150 GUCACAAUCUAUGGGGUCGUAGA We employed either pre-designed LNA™ PCR primer sets for miRCURY LNA™ Universal RT microRNA PCR or Custom LNA™ PCR primers (UniRT) (Exiqon A/S, Vedbaek, Denmark). [score:1] p) < 0.003] and of mmu-miR-1971 (FC 0.82, corr. [score:1] Instead, our data suggest an involvement of mmu-miR-1971 in the therapeutic action of fluoxetine in footshocked mice. [score:1] Two out of the five array-identified miRNA candidates (rno-miR-3559-p, mmu-miR-1971, ebv-miR-BART8-3p, mmu-miR-1947-3p, mmu-miR-33-5p) could be validated by miRCURY LNA™ RT-qPCR: calculation of the statistical significance of RT-qPCR results with two-way ANOVA followed by Bonferroni post hoc correction confirmed a statistical trend toward a fluoxetine -mediated increase in prefrontal cortical mmu-miR-33-5p expression in shock-fluoxetine mice comparison to no-shock-fluoxetine mice (Figure 5C: Bonferroni posttest of shock-fluoxetine versus no-shock-fluoxetine: t = 2.205, p = 0.055). [score:1] However, to our knowledge, the in that study newly identified miRNA sequence, which was termed hsa-miR-1971 thereby representing it as the human homolog of murine mmu-miR-1971, is not annotated in miRBase 19.0. [score:1] [1 to 20 of 23 sentences]
2	[+] score: 4 Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-132, mmu-mir-135a-1, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-30e, mmu-mir-299a, mmu-let-7d, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, mmu-mir-329, mmu-mir-135b, mmu-mir-1a-2, mmu-mir-212, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-411, mmu-mir-433, mmu-mir-466a, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-92b, mmu-mir-466d, mmu-mir-466l, mmu-mir-466i, mmu-mir-1b, mmu-mir-669f, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-466c-3, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3 Schmidt U. Herrmann L. Hagl K. Novak B. Huber C. Holsboer F. Wotjak C. T. Buell D. R. Therapeutic Action of Fluoxetine is Associated with a Reduction in Prefrontal Cortical miR-1971 Expression Levels in a Mouse Mo del of Posttraumatic Stress DisorderFront. [score:3] The therapeutic action of fluoxetine in shocked mice was associated with a significant reduction of miR-1971 in the cortex [30]. [score:1] [1 to 20 of 2 sentences]

Then, we used computational methods to predict potential target genes of mmu-miR-1971: we applied TargetScanMouse 6.2 [4] (53) and MirTarget2 [5] (54, 55); we included only those predicted target genes that were identified with both approaches into subsequent GO analysis by employing GenericGeneOntologyTermFinder [6] (56) and REViGO [7] (57) (Table 2). [score:9]

Taken together, target prediction and GO analyses revealed several predicted target genes of mmu-miR-1971 and several validated target genes mmu-miR-33-5p which might possibly be involved inter alia in PTSD pathobiology or fluoxetine -mediated alterations of molecular pathways. [score:7]

Finally, to get an idea of the potential role of mmu-miR-1971 and mmu-miR-33-5p in PTSD and of their general function, we performed an in silico analysis of target genes regulated by these two miRNA candidates: analysis performed with the miRWalk database [3] (52) revealed several validated target genes of mmu-miR-33-5p (Table 3), but none of mmu-miR-1971. [score:6]

However, GO analysis of predicted miR-1971 target genes allude that this above-average small (18nt) miRNA candidate might be involved inter alia in basic metabolic processes like heterocycle and organic substance metabolism (Table 2: p = 2.27E−06 and p = 3.73E−05, respectively); neurotransmitters like serotonin or modulators of the serotonergic tone might belong to the organic substances whose metabolism is targeted by miR-1971, but, however, our GO analysis provided no direct hint for this speculation. [score:6]

Our miRNA target prediction and GO analysis revealed that for miR-1971 no target genes have been validated so far (Table 2). [score:5]

Instead, in the only study reporting expression level changes of miR-1971 demonstrated that, in the bone marrow, miR-1971 was differentially expressed between patients suffering from acute lymphoblastic leukemia (ALL) and healthy donors (59). [score:5]

Here, we present the first study exploring miRNA expression profiles in a. In summary, we demonstrate that the therapeutic action of fluoxetine in shocked mice (Figure 1) is correlated with a significant reduction in prefrontal cortical mmu-miR-1971 expression levels on day 74 after shock exposure (Figures 1 and 5A). [score:5]

Taken together, microarray analyses revealed that, in shocked mice, on day 74 after subjection of mice to footshock, the therapeutic effect of fluoxetine (Figure 1) went along with a significant decrease in prefrontal cortical rno-miR-3559-3p and mmu-miR-1971 expression as well as with a trend of reduction in prefrontal cortical ebv-miR-BART8-3p and mmu-miR-1947-3p expression (Figure 3A). [score:5]

The molecular functions of predicted mmu-miR-1971 target genes are mainly associated with small molecule and nucleic acid binding (Table 2). [score:3]

Interestingly, we found that traumatic stress per se and fluoxetine treatment per se did not lead to significant alterations of mouse miRNA profiles on day 74 after trauma exposure (Figures 2 and 4) which suggests that fluoxetine interacts with traumatic stress to alter expression levels of mmu-miR-1971 and mmu-miR-33-5p (Figures 5A,C). [score:3]

Figure 5 RT-qPCR analysis confirmed that fluoxetine treatment alters the expression of mmu-miR-1971 and mmu-miR-33-5 in the PFC of shocked mice. [score:3]

Most important, we observed a statistically significant reduction in mmu-miR-1971 expression in the PFC of shock-fluoxetine mice in comparison to shock-vehicle mice (Figure 5A: Bonferroni posttest of shock-vehicle versus shock-fluoxetine: t = 2.509, p < 0.050). [score:3]

In summary, the most important conclusion of this study is that in the studied here, the therapeutic action of fluoxetine (Figure 1) is accompanied by a significant reduction in prefrontal cortical mmu-miR-1971 expression on day 74 after shock exposure (Figures 3A and 5B). [score:3]

RT-qPCR data do not allow the conclusion that fluoxetine rescues the footshock -induced increase in mmu-miR-1971 expression, since the latter failed to survive correction for multiple testing (Figure 5A). [score:3]

RT-qPCR data do not allow the conclusion that fluoxetine rescues the footshock -induced increase in mmu-miR-1971 expression, since the latter failed to survive statistical correction (Figure 5A). [score:3]

RT-qPCR analysis confirmed that fluoxetine treatment alters the expression of mmu-miR-1971 and mmu-miR-33-5p in the PFC of shocked mice. [score:3]

Hence, regulation and function of miR-1971 are largely unexplored yet and await further studies. [score:2]

Depicted are results of the RT-qPCR analysis of the relative expression levels of the candidate microRNAs mmu-miR-1971 (A), mmu-miR-1947-3p (B), and mmu-miR-33-5p (C) compared between the no-shock-vehicle, no-shock-fluoxetine, shock-vehicle, and shock-fluoxetine groups (n = 6 per group). [score:2]

/design ID (custom) Target miRNA sequence mmu-miR-33-5p 204632 GUGCAUUGUAGUUGCAUUGCA mmu-miR-100-5p 204133 AACCCGUAGAUCCGAACUUGUG mmu-miR-1971 206999 (custom)/design ID 212160 GUAAAGGCUGGGCUGAGA mmu-miR-1947-3p 206999 (custom)/design ID 212154 GCACUGAGCUAGCUCUCCCUCC rno-miR-3559-3p 206999 (custom)/design ID 212147 AUGUAGUACUGAGUCUGUCGUG ebv-miR-BART8-3p 206999 (custom)/design ID 212150 GUCACAAUCUAUGGGGUCGUAGA We employed either pre-designed LNA™ PCR primer sets for miRCURY LNA™ Universal RT microRNA PCR or Custom LNA™ PCR primers (UniRT) (Exiqon A/S, Vedbaek, Denmark). [score:1]

p) < 0.003] and of mmu-miR-1971 (FC 0.82, corr. [score:1]

Instead, our data suggest an involvement of mmu-miR-1971 in the therapeutic action of fluoxetine in footshocked mice. [score:1]

Two out of the five array-identified miRNA candidates (rno-miR-3559-p, mmu-miR-1971, ebv-miR-BART8-3p, mmu-miR-1947-3p, mmu-miR-33-5p) could be validated by miRCURY LNA™ RT-qPCR: calculation of the statistical significance of RT-qPCR results with two-way ANOVA followed by Bonferroni post hoc correction confirmed a statistical trend toward a fluoxetine -mediated increase in prefrontal cortical mmu-miR-33-5p expression in shock-fluoxetine mice comparison to no-shock-fluoxetine mice (Figure 5C: Bonferroni posttest of shock-fluoxetine versus no-shock-fluoxetine: t = 2.205, p = 0.055). [score:1]

However, to our knowledge, the in that study newly identified miRNA sequence, which was termed hsa-miR-1971 thereby representing it as the human homolog of murine mmu-miR-1971, is not annotated in miRBase 19.0. [score:1]

[1 to 20 of 23 sentences]

miRBase

2 publications mentioning mmu-mir-1971