sort by

19 publications mentioning gga-mir-10a

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-10a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 13
In the mature and immature chicken ovary libraries, known miRNAs had a broad range of expression levels; some (such as miR-10a, 21 and 101) were found to have more than hundreds of thousands of sequence reads, while others (such as miR-124a, 3540 and 1759) had less than 20 (Additional file 1: Table S2), indicating that expression varies significantly among different miRNA families. [score:5]
The following 15 miRNAs were dominantly expressed in the two libraries: gga-miR-10a, gga-miR-146c, gga-miR-101, gga-miR-21, gga-let-7a, gga-let-7b, gga-let-7c, gga-let-7j, gga-let-7f, gga-let-7 k, gga-miR-30a-5p, gga-miR-30e, gga-miR-148a, gga-miR-100 and gga-miR-126. [score:3]
In the sexually mature chicken ovary library, gga-miR-10a and gga-miR-21 were the two most frequently sequenced miRNAs, and the let-7 miRNA family was another abundant cluster with let-7a being the most abundantly expressed miRNA. [score:3]
The most abundant miRNA in the mature ovary was gga-miR-10a, which had 1,177,256 reads, followed by gga-miR-21, which had 929,545 reads. [score:1]
The three most abundant miRNAs in the chicken ovary are gga-miR-10a, gga-let-7 and gga-miR-21. [score:1]
[1 to 20 of 5 sentences]
2
[+] score: 9
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
[1 to 20 of 2 sentences]
3
[+] score: 8
Expression patterns of 15 miRNAs identified using RT-PCR agreed with those identified using deep sequencing, miR-101, miR-10a, miR-10b, miR-1677, let-7f, and miR-31 were higher in layers, while miR-200b, let-7c, miR-16c, miR15b, miR-15c, miR460, miR-429, miR-2188, and the novel miR-N2 were higher in broilers. [score:3]
Intriguingly, miR-10 has been shown decreases expression of several Hox genes in zebrafish [78]. [score:3]
Notably, the novel miR-10a was confirmed with a high number of reads (28,660), and miR-10b was the most abundant (113,106) among known miRNAs, implying that these two miRNAs are related during somite development. [score:2]
[1 to 20 of 3 sentences]
4
[+] score: 8
In the mouse embryo, miR-10a is mainly expressed in a region of the posterior trunk [30]. [score:3]
The miRNAs miR-10a and miR-10b are reportedly involved in cell proliferation and regulation of the cell cycle [31]. [score:2]
MiR-10a reportedly plays an important role in regulation of squamous cell growth in the neck area [28]. [score:1]
The miRNAs miR-10a and miR-10b are close homologs, differing only by a single central nucleotide [29]. [score:1]
The most abundant miRNAs were gga-miR-10a and gga-miR-10b, which represented more than 2,000,000 TPM within 18 libraries. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 8
Seven (miR-101, miR-10a, miR-10b, miR-1677, let-7f, miR-31, and miR-205b) were expressed at higher levels in layers, and ten (miR-203, miR-200b, miR-16c, miR-15b, miR-15c, miR-460, miR-429, let-7c, miR-2188, and gga-miR-N2) were expressed at higher levels in broilers. [score:5]
Six of these miRNAs (miR-31, miR-10a, miR-10b, miR-16C and two let-7 members) have been implicated in skeletal muscle regeneration or development [39- 42]. [score:2]
Recent studies have reported that miR-10 contributes to retinoic acid -induced smooth muscle cell differentiation [41], and may be important during the early stage of embryonic myogenesis [59]. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 7
Last but not least, expression levels of 10 miRNAs can be perturbed in animals when fed with high-fat diet (miR-142–5p and miR-101) [74– 78], or with obesity or obesity-related diseases (miR-10a, miR-218, miR-429, miR-200a, miR-200b, miR-451, miR-142–3p, and miR-454) [77, 79– 85], which indicates that they could be potentially related to adipogenesis. [score:5]
Three other miRNAs, gga-miR-148a, gga-miR-146c and gga-miR-10a were more abundant in the lean line than in the fat line. [score:1]
The top 10 abundant miRNAs included the let-7 miRNA family (let-7a, j, b, f, c, and k), gga-miR-148a, gga-miR-146c, gga-miR-10a, and gga-miR-21. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Previous studies revealed that five miRNA genes as well as their host genes (hsa-mir-10a/ HOXB4, hsa-mir-126/ EGFL7, hsa-mir-152/ COPZ2, hsa-mir-191/ DALRD3, and hsa-mir-342/ EVL) were found to be epigenetically downregulated, either by histone modification and/or CpG island hypermethylation in the promoter region in cancer cells [27], [86]– [89] (Table 2 ). [score:4]
C) MicroRNA gene hsa-mir-10a located within two overlapping protein-coding genes. [score:1]
For example hsa-mir-10a overlapped with both, HOXB3 (homeobox B3) and HOXB4 (homeobox B4) (Figure 3C ). [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 5
For instance, although miRNAs are known to predominantly act in translational repression, miR-10 has been recently found to bind a group of transcripts containing a terminal oligo-pyrimidine (TOP) motif and to induce their translation [47]. [score:5]
[1 to 20 of 1 sentences]
9
[+] score: 4
Other miRNAs from this paper: gga-mir-133b
miR-10a regulates proliferation of human cardiomyocyte progenitor cells by targeting cardiac transcription factor GATA6 [56]. [score:4]
[1 to 20 of 1 sentences]
10
[+] score: 4
The miRNAs predicted to target these genes were mainly miR-21-5p, miR-100-5p, miR-148a-3p, let-7f-5p, and miR-10a-5p. [score:3]
Our Venn analysis of the most abundant mature miRNAs with counts >= 10000 in the PGCs, SSCs, and Sp cells identified 11 miRNAs that were common in the three types of cells, including miR-21-5p and miR-10a-5p. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
Others, the mir-10, 99, 100, 125 family for example, diverge in the mature forms (See additional file 8: The mir-10, 99, 100, 125 family). [score:1]
Sequence alignment and selected secondary structure of the miRNAs in the mir-10, 99, 100, 125 family. [score:1]
Click here for file The mir-10, 99, 100, 125 family. [score:1]
The mir-10, 99, 100, 125 family. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 3
Most of the changed microRNAs are involved in development (especially in the embryonic development) and some examples of them are miRNA-222, miRNA-383, miRNA-126, miRNA-133, miRNA-30, miRNA-10a, miRNA-196 and miRNA-18b. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-16c, gga-mir-214, sma-let-7, sma-mir-71a, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Notably, a study published after submission of this manuscript identified 5 miRNAs derived from S. japonicum in the plasma of infected rabbits and 3 of these are identical or homologous to those identified here: bantam, miR-3479-3p and miR-10-5p [70], providing independent validation for the presence of trematode miRNAs in the serum of infected animals. [score:1]
22962218:+ 7 sma-miR-10-5p AACCCUGUAGACCCGAGUUUGG S_mansoni. [score:1]
The other 2 miRNAs, sma-miR-10-5p and sma-let-7-3p, were excluded from analysis because they are highly similar to homologous mouse miRNAs that are present at >100 fold higher read frequencies (Table S3). [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 3
miRNAs Normalized Reads Total Reads WRRh WRRl XHh XHl gga-miR-133a 3,558,683 3,069,071 1,997,286 2,607,787 11,232,827 gga-miR-133c 3,350,936 2,885,440 1,878,925 2,449,209 10,564,510 gga-miR-133b 3,326,848 2,864,578 1,864,721 2,431,274 10,487,421 gga-let-7a 1,699,621 1,513,865 857,210 1,133,532 5,204,228 gga-miR-22-3p 1,333,233 1,145,421 712,464 988,186 4,179,304 gga-miR-30a-5p 1,213,468 1,148,128 790,893 930,507 4,082,996 gga-miR-26a 1,212,635 1,054,689 691,456 1,006,522 3,965,302 gga-miR-30d 851,887 813,262 583,932 667,002 2,916,083 gga-miR-181a-6p 918,452 836,452 485,661 650,836 2,891,401 gga-miR-10a-5p 943,686 782,180 420,809 663,401 2,810,076 gga-miR-10b 911,725 757,564 398,852 633,567 2,701,708 gga-miR-30e 799,679 730,832 501,718 596,218 2,628,447 gga-let-7j 848,972 756,205 428,182 566,165 2,599,524 gga-let-7f 398,292 363,598 206,995 274,333 1,243,218 gga-miR-148a 288,585 300,432 144,015 180,973 914,005 gga-miR-146c-5p 224,147 207,782 171,443 132,712 736,084 gga-let-7k 211,853 206,518 118,297 155,412 692,080 gga-let-7c 242,661 189,820 111,118 139,257 682,856 gga-miR-199-3p 168,417 152,158 75,346 121,460 517,381 gga-miR-126-5p 139,914 109,805 89,607 86,681 426,007 Differentially expressed miRNAs were identified by DEGseq analysis (fold change > 1.5 or < 0.66; p-value < 0.05; q-value < 0.01), as a result, 200, 279, 257 and 297 miRNAs were detected in four comparisons of WRRh vs. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 2
Similarly, we detected three miRNAs (Bantam, miR-3479, and miR-10) in the plasma of mice infected with S. japonicum (Cheng et al., 2013). [score:1]
Moreover, in our recent work, five pathogen-specific miRNAs were identified in the plasma of rabbits infected with S. japonicum, including four known miRNAs (Bantam, miR-3479, miR-10, and miR-3096), and one novel miRNA (sja-miR-8185) (Cheng et al., 2013). [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 2
The novel miRNAs 7_32745, 17_11642, 7_32911 and 15_10888 were homologous with miR-10a-5p, miR-181a-5p, miR-26-5p and miR-130a-3p respectively (Supplementary Table 2). [score:1]
The 20 most abundant miRNAs in the three groups were ordered by the average proportion of each miRNA and included miR-148a-3p, miR-22-3p, miR-10b-5p, miR-181a-5p, miR-133a-3p, miR-126-5p, let-7f-5p, miR-10a-5p, miR-30c-5p, miR-146c-5p (Supplementary Table 1). [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 1
In addition, some other miRNAs, such as miR-148a, miR-122, miR-21-5p, Let-7f-5p, miR-26a-5p, miR-126-5p, miR-30d, and miR-10a-5p, were also highly abundant in chicken liver. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
The most abundant miRNA was miR-2188-5p, which represented 19% of total reads, followed by gga-miR-10b (gga-miR-10b-5p in miRBase v20), gga-miR-10a-5p, and gga-miR-146c-5p, which together represented about 36% of the total reads (13.3%, 13.9% and 9.2% respectively). [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
The other seven miRNAs (miR-460B-5P, miR-383-5p, miR-181b-5p, gga-let-7b, miR-301b-3p, miR-10a-3p and miR-217-5p) created the other half of the network, interacting with 13 other protein-coding genes that are related to the immune system, hemarthrosis, arteriosclerosis obliterans, apoptosis, survival caspase cascade and muscular dystrophy. [score:1]
[1 to 20 of 1 sentences]