sort by

8 publications mentioning hsa-mir-1297

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1297. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 197
The results demonstrated that the mRNA and protein levels of HMGB2 were significantly decreased after knockdown of MALAT1 and was upregulated by miR-1297 inhibitor in the MKN45 cells, and the reduced expression of HMGB2 when knockdown of MALAT1 could be restored by co-transfecting with si-MALAT1 and miR-1297 inhibitor (Fig.   3a, b). [score:12]
Next, we explored the expression of miR-1297 when MALAT1 was knocked down in MKN45 and MKN28 cells, and results demonstrated knockdown MALAT1 expression caused a significantly increase of miR-1297 expression (Fig.   2e). [score:9]
Moreover, miR-1297 was up-regulated after MALAT1 silencing, notably, ectopic expression of miR-1297 increased the MALAT1 expression levels. [score:8]
a, b The mRNA and protein expression of HMGB2 after transfecting si-NC, si-MALAT1, si-MALAT1 and miR-1297 inhibitor in MKN45 cells was detected by qRT-PCR assays and western-blotting analysis, **P < 0.05. c, d The mRNA and protein expression of HMGB2 after transfecting si-NC, si-MALAT1, si-MALAT1 and miR-1297 inhibitor in MKN28 cells was detected by qRT-PCR assays and western-blotting analysis. [score:7]
e The miR-1297 expression in MKN45 and MKN28 cells was detected after MALAT1 silencing by qRT-PCR assays, the internal control was U6, **P < 0.05. f The MALAT1 expression in MKN45 or MKN28 cells was detected after transfecting miR-1297 by qRT-PCR assays, the internal control was GAPDH, **P < 0.05. g Co-transfection of miR-1297 mimic and PMIRGLO-MALAT1-WT strongly decreased the luciferase activity, while co-transfection of miR-1297 mimic and PMIRGLO-MALAT1-MUT and NC group did not change the luciferase activity, h Co-transfection of PmiRGLO-miR-1297-WT and MALAT1 overexpressed plasmid strongly decreased the luciferase activity, while co-transfection of PMIRGLO-miR-1297-MUT and MALAT1 overexpressed plasmid did not change the luciferase activity, were represented as the average ± SD based on 3 independent experiments. [score:7]
Moreover, transfect with a luciferase reporter vector containing miR-1297 binding site-WT into the BCG-823 cells that expressed lower MALAT1 levels together with increasing amounts of a plasmid that expressed MALAT1 inhibited the miR-1297 binding site-WT luciferace activity (Fig.   2h). [score:7]
In addition, transwell cell invasion assay also revealed that knockdown of MALAT1 efficiency inhibited the cell invasion abilities in MKN45 or MKN28 cells, and this inhibition could be restored by co-transfecting with si-MALAT1 and miR-1297 inhibitor (Fig.   4c, f). [score:7]
In our study, knockdown of MALAT1 was able to reduce the mRNA and protein levels of HMGA2 and miR-1297 inhibitor could enhanced the HMGB2 expression. [score:6]
a, b CCK8 cell proliferation was performed to detect the cell abilities after MALAT1 down-regulation, and was rescued by miR-1297 inhibitor treatment in MKN45 or MKN28 cells, **P < 0.05. n. s. not statistics significant. [score:6]
c– f Transwell cell invasion assays and analysis were performed to detect the cell abilities after MALAT1 down-regulation, and were rescued by miR-1297 inhibitor treatment in MKN45 or MKN28 cells, **P < 0.05. n. s. not statistics significant. [score:5]
Compared to the normal tissues, the expression of miR-1297 was markedly downregulated in GC tissues and cells (Fig.   2b, c). [score:5]
Furthermore,Pearson correlation analysis confirmed that MALAT1 expression level was negatively related to miR-1297 expression level in GC tissues (r = −0.317, P < 0.05, Fig.   2d). [score:5]
Mechanistically, our results demonstrated that MALAT1 was negatively correlation with miR-1297 and functioned as a molecular sponging miR-1297, antagonizing its ability to suppress HMGB2 expression. [score:5]
Previous study showed that miR-1297 inducing HCC cell apoptosis and inhibited cell the proliferation and invasion by targeting HMGB2 [17]. [score:5]
Mechanistically, we found that MALAT1 functioned as a molecular sponge for miR-1297, antagonizing its ability to inhibit HMGB2 protein expression. [score:5]
A previous study found that miR-1297 promoted apoptosis and inhibited the proliferation and invasion of hepatocellular carcinoma cells by targeting HMGA2 [17]. [score:5]
In vitro studies further confirmed that MALAT1 negatively regulated miR-1297 expression levels, which promoted cell proliferation and cell invasion. [score:4]
c The miR-1297 expression in gastric cancer cells and an immortalized normal gastric epithelial cell line GES-1 was detected by qRT-PCR assays, the internal control was U6, **P < 0.05. d Pearson correlation analysis was used to detect the significance of association between MALAT1 and miR-1297 expression. [score:4]
What’s more, knockdown of MALAT1 could reduce the mRNA and protein levels of HMGA2 which was dismissed by miR-1297 inhibitor. [score:4]
Fig.  2MALAT1 directly targeted miR-1297 in GC cells. [score:4]
Thus, our results indicated that intervention of MALAT1/miR-1297/HMGB2 regulator pathway could inhibit gastric cancer progression. [score:4]
Therefore, the results demonstrated that MALAT1 negatively regulated miR-1297 and promote the HMGB2 expression in gastric cancer progression. [score:4]
In conclusion, we demonstrated that MALAT1 was significantly overexpressed in gastric cancer tissues and cell lines and revealed a MALAT1/miR-1297/HMGB2 regulator pathway in GC. [score:4]
Fig.  4MALAT1 regulated miR-1297 expression and promoted gastric cancer cell proliferation and invasion. [score:4]
Moreover, we also found that the mRNA and protein levels of HMGB2 were remarkably decreased after knockdown of MALAT1 in the MKN 28 cells,and this reduction could be restored by co-transfecting with si-MALAT1 and miR-1297 inhibitor (Fig.   3c, d). [score:4]
Taken together, these results demonstrated that MALAT1/miR-1297/HMGB2 axis acted as critical regulator pathway in GC tumorigenesis and progression, which provided a novel therapeutic target for gastric cancer. [score:4]
Thus, based on above result, we also investigated whether MALAT1 could regulate the expression of the miR-1297 targeting HMGB2. [score:4]
To further explore the potential correlation between MALAT1 and miR-1297, we examined the expression level of miR-1297 in GC tissues. [score:3]
Moreover, full-length MALAT1 by PCR was constructed and were transfected with a luciferase reporter vector containing perfect miR-1297 binding site (Sensor) wild type (WT) or mutant type (MUT) into theBCG-823 cells that expressed lower MALAT1 levels. [score:3]
On the other hand, MALAT1 was significantly inhibited by transfecting the miR-1297 plasmid into MKN45 and MKN28 cells (Fig.   2f). [score:3]
MiR-1297 is a direct target of MALAT1. [score:3]
Pearson correlation analysis was used to detect the significance of association between MALAT1 and miR-1297 expression. [score:3]
a Bioinformatic analysis identified a potential miR-1297 target site of MALAT1 by software starbase (http://starbase. [score:3]
CCK8 assays revealed that knockdown of significantly reduced the MKN45 and MKN28 cell proliferation abilities, and this reduction could be restored by co-transfecting with si-MALAT1 and miR-1297 inhibitor (Fig.   4a, b). [score:3]
was used to determine miR-1297 was a target of MALAT1. [score:3]
To sum up, our findings revealed that MALAT1 might function as a competing endogenous RNA (ceRNA) sponge for miR-1297 modulating HMGB2 expression. [score:3]
MALAT1 regulates miR-1297 to promote gastric cancer cell proliferation and invasion. [score:2]
MALAT1 regulates miR-1297 to modulate HMGB2 in gastric cancer cells. [score:2]
These results demonstrated that there exist a negative regulation between MALAT1 and miR-1297. [score:2]
The MALAT1/miR-1297/HMGB2 regulator pathway provided a novel therapeutic method for gastric cancer. [score:2]
Our results confirmed that MALAT1 promoted HMGB2 through negatively regulating miR-1297. [score:2]
Fig.  3MALAT1 regulated miR-1297 to modulate HMGB2 in gastric cancer cells. [score:2]
These findings demonstrated that there exist a negative regulation between MALAT1 and miR-1297. [score:2]
The predicted miR-1297 binding site (MALAT1-WT) and its mutant type (MALAT1-MUT) were amplified and directly fused to the downstream of the luciferase reporter gene in the PMIRGLO-basic vector (Fig.   2a). [score:2]
b The miR-1297 expression levels in 78 pairs of gastric cancer and corresponding non-cancerous gastric tissues was detected by qRT-PCR assays. [score:2]
Gastric cancer (GC) Long non-coding RNA MALAT1 miR-1297 HMGB2 Gastric cancer is the most common form of gastrointestinal cancer and a leading cause of cancer-related mortality worldwide [1]. [score:1]
PMIRGLO-MALAT1 wild type (WT) or pMIRGLO-MALAT1 mutant type (MUT) reporter plasmid was co -transfected with miR-1297 mimic or NC mimic into MKN45 cells. [score:1]
The results showed that co-transfetion of miR-1297 and PMIRGLO-MALAT1-WT significantly decreased the luciferase activity, whereas co-transfection of miR-NC and PMIRGLO-MALAT1-MUT did not change the luciferace activity (Fig.   2g). [score:1]
We found that miR-1297 had a binding site in MALAT1 (Fig.   2a). [score:1]
[1 to 20 of 49 sentences]
2
[+] score: 130
Our results showed that miR-511 and miR-1297 could inhibit A549 cell proliferation by downregulation of TRIB2 and upregulation of C/EBPα. [score:9]
Our results demonstrate that miR-511 and miR-1297 could inhibit A549 cell proliferation by suppressing TRIB2 expression and thus increasing C/EBPα expression. [score:9]
In summary, our results demonstrated that C/EBPα, as the downstream factor of TRIB2, was up-regulated after miR-511 (or miR-1297) treatment, and that miR-511 (or miR-1297) acts as a tumor suppressor genes to induce A549 cell apoptosis by targeting the oncogene TRIB2. [score:8]
TRIB2–3′UTR is regulated by miR-511 and miR-1297The relationship between the TRIB2–3′-UTR and its targeted miRNAs was predicted using microRNA analysis software, which showed that the 3′UTR of TRIB2 might be targeted by miR-511, miR-1297, et al (Figure 2A), which were not published before. [score:6]
The results showed that C/EBPα was increased in miR-511- and miR-1297 -treated cells compared with NC -treated cultures after miR-511/1297 inhibiting TRIB2 expression, while C/EBPα was decreased after over -expression TRIB2 by transfecting pcDNA-TRIB2 vector (Figure 4E, F). [score:6]
0046090.g004 Figure 4(A, B) lung adenocarcinoma A549 cells were treated with miRNAs and their controls, TRIB2 expression was detected and the results showed that its expression in the miR-511- and miR-1297 -treated cultures was much lower than that of NC-(or mutation miRNA) -treated cultures (*p<0.01). [score:6]
TRIB2 expression was detected in xenografts and the results showed that its expression in the miR-511- and miR-1297 -treated xenografts was lower than that of NC -treated controls (*p<0.05). [score:5]
We also showed that inhibition of TRIB2 expression by its relevant miRNA (miR-511 or miR-1297) could induce tumor cell apoptosis. [score:5]
The expression of TRIB2 was further found to be suppressed by miR-511 and miR-1297. [score:5]
The relationship between the TRIB2–3′-UTR and its targeted miRNAs was predicted using microRNA analysis software, which showed that the 3′UTR of TRIB2 might be targeted by miR-511, miR-1297, et al (Figure 2A), which were not published before. [score:5]
Our results showed that miR-511 and miR-1297 could downregulate the GFP expression compared with NC -treated cells. [score:5]
We first investigated this miRNA function in this study, and a novel finding is that the expression of TRIB2 could be regulated by miR-511 and miR-1297, which also increased C/EBPα expression. [score:4]
The intensity of GFP expression was weaker and the number of GFP -positive cells was fewer in miR-1297 -treated cells than mutation control (Figure S2 A). [score:4]
As the one factor known to be regulated by TRIB2 [13], C/EBPα expression was increased after miR-511 (or miR-1297) treatment. [score:4]
The intensity of GFP expression was weaker and the number of GFP -positive cells was fewer in miR-1297 -treated cells than mutation control cultures (Figure S1 A). [score:4]
Our results demonstrated that the apoptotic rate was increased in the miR-511 (or miR-1297) -treated cells compared with the negative-control miRNA (NC) -treated cells, and these miRNAs could reduce adenocarcinoma cell proliferation by inhibiting TRIB2 expression. [score:4]
For example, the percentage of GFP -positive cells in the miR-511 (or miR-1297) -treated culture was 29.7% (or 25.8%), much lower than NC control culture (40.8%) (Figure 3B), the other miRNAs (miR-26a, miR-125a, miR-132) did not inhibit GFP expression appreciably compared with the control cultures (data not shown). [score:4]
In addition, cell apoptosis was prominent in miR-511- (or miR-1297) -treated cells contrasted with the negative control cultures, suggesting that miR-511 and miR-1297 possibly act as tumor suppression miRNAs. [score:3]
The miR-511 and miR-1297 levels were found to be higher (Figure 6 C) and TRIB2 expression was decreased in miRNA -treated groups (Figure 6 D). [score:3]
We predicted the possible miRNAs (miR-511 and miR-1297, among others) which could possibly targeting TRIB2 by using microRNA analysis software online. [score:3]
Study of the TRIB2 oncogene and its related miRNAs miR-511 and miR-1297) may provide new targets for lung cancer therapy. [score:3]
Particularly, the intensity of fluorescence in the miR-511- and miR-1297 -treated cells provided the strongest inhibitory effect. [score:3]
When we mutated the seed sequences of miR-511/1297, the expression of GFP was not decreased obviously in mut-miR-511- or mut-miR-1297 -treated cells compared with miR-511- or miR-1297 -treated cells (Figure S1). [score:2]
From A and B, A549 cell xenografts were inhibited and smaller tumor volumes were detected in miR-511- and miR-1297 -treated tumors compared with the NC -treated tumors. [score:2]
TRIB2–3′UTR is regulated by miR-511 and miR-1297. [score:2]
The expression of TRIB2 in mut-miR-511- or mut-miR-1297 -treated cells was not reduced compared with miR-511- or miR-1297 -treated cells (Figure 4A, B). [score:2]
The percentage of GFP -positive cells in miR-1297 -treated cultures was much lower than that of mutation control (Figure S2 B). [score:2]
The results showed that the intensities of fluorescence from the miRNA -treated cultures was weaker and the percentage of GFP -positive cells in miR-511 (or miR-1297) -treated cultures was also much lower than the NC-or mut-miRNAs -treated cells (Figure S2), and the TRIB2 expression was significantly decreased in miR-511/1297 -treated cultures compared with NC-, mu-miR-511-, or mu-miR-1297 -treated cultues (Figure 4C, D). [score:2]
After isolation of miRNAs from xenografts, higher miR-511 and miR-1297 levels were found in the miR-511- and miR-1297 -treated xenografts than controls. [score:1]
The intensity of GFP -positive cells was weaker and the number of GFP -positive cells was fewer in miR-511- or miR-1297 -treated cells than that of control cultures. [score:1]
NC, miR-511, miR-1297, mut-miR-511, mut-miR-1297, and pcDNA-TRIB2, cells treated with NC, miR-511, miR-1297, mut-miR-511, mut-miR-1297, and pcDNA-TRIB2 vector, respectively. [score:1]
a Oligos Sequence (5′→3′) miR-511 sense gugucuuuugcucugcaguca antisense ugacugcagagcaaaagacacuu miR-1297 sense uucaaguaauucaggug antisense caccugaauuacuugaauu miR-26a sense uucaaguaauccaggauaggcu antisense agccuauccuggauuacuugaauu negative control(NC) sense caguacuuuuguguaguacaa antisense Guacuacacaaaaguacuguu mut-miR-511 sense gu au acuuugcucugcaguca * antisense ugacugcagagcaaaguauacuu mut-miR-1297 sense uu ga uauaauucaggug * antisense caccugaauuauaucaauu a The selected miRNAs were chemically synthesized in the form of small interfering RNA (siRNA) duplexes. [score:1]
miR-511, miR-1297 and miR-26a are shown. [score:1]
miR-511 and miR-1297 are novel miRNAs and their functions in tumor cell proliferation are not clear. [score:1]
results showed little to no detectable apoptosis in the negative and NC -treated cells, while the percentage of apoptotic cells in the miR-511- and miR-1297 -treated cultures were 26.5% and 18.1%, respectively, significantly higher than the controls (Figure 5B). [score:1]
Research about miR-1297 has not been reported previously. [score:1]
FACS results showed that the ratio of GFP -positive cells in miR-1297 -treated cultures was much lower than that of mut-miR-1297 -treated cells (Figure S1 B). [score:1]
24 h after lung adenocarcinoma cells were treated with miRNAs, higher miR-511 and miR-1297 levels were found in the transfected cells than in the non -transfected cells. [score:1]
[1 to 20 of 38 sentences]
3
[+] score: 8
Besides, miRNAs miR-511 and miR-1297 act as LN tumor suppressor genes, which could suppress adenocarcinoma cell proliferation in vitro and in vivo by indirectly increasing CCAAT/enhancer -binding protein alpha expression [71]. [score:8]
[1 to 20 of 1 sentences]
4
[+] score: 7
Other miRNAs from this paper: hsa-mir-99a, hsa-mir-148a, hsa-mir-34a, hsa-mir-449a
HOXA11-AS also functions as a molecular sponge for miR-1297 and antagonizes its repressive function on EZH2 translation, which results in cell cycle progression and cell proliferation in GC. [score:3]
In gastric cancer, HOXA11-AS not only acts as a scaffold for EZH2, LSD1 and DNMT1 but also functions as a molecular sponge for miR-1297 to antagonize its repressive effect on EZH2 translation [64]. [score:3]
These findings suggest that HOXA11-AS/miR-1297/EZH2 cross-talk plays a critical role in cell growth, migration, invasion, and apoptosis. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 6
Wang MicroRNA-1297 inhibits the growth and metastasis of colorectal cancer by suppressing cyclin D2 expressionDNA Cell Biol. [score:6]
[1 to 20 of 1 sentences]
6
[+] score: 3
Other miRNAs from this paper: hsa-mir-1296
Clinical significance of miR-1297 and SRPK1 expression for HCC patients. [score:3]
[1 to 20 of 1 sentences]
7
[+] score: 1
The fact that three of these molecules (mir-548d-1, mir-1297 and mir-616) display the sequence AGA instead of the canonical ACA box could indicate that they have evolved sufficiently to no longer retain H/ACA snoRNA functionality. [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3
Sun et al. [31] revealed that HOXA11-AS served as a critical effector in gastric cancer tumorigenesis and progression via HOXA11-AS/miR-1297/EZH2 crosstalk. [score:1]
[1 to 20 of 1 sentences]