72 publications mentioning rno-mir-17-2

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-17-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1

Consistent with this notion, we found that TXNIP mRNA and protein levels were downregulated by administrating miR-17-5p mimic, whereas anti-miR-17-5p inhibitor upregulated TXNIP expression in the neonatal HI mo del.

Pups were randomly divided into seven groups: naive, negative control for mimic, mir-17-5p mimic-0.05 (Syn-rno-miR-17-5p miScript miRNA mimic 0.05 nmol), mir-17-5p mimic-0.5 (Syn-rno-miR-17-5p miScript miRNA mimic 0.5 nmol), negative control for inhibitor, mir-17-5p inhibitor-0.1 (Anti-rno-miR-17-5p miScript miRNA inhibitor 0.1 nmol), and mir-17-5p inhibitor-1 (Anti-rno-miR-17-5p miScript miRNA inhibitor 1 nmol) (n = 6/group).

miR-17-5p inhibitor-0.1 or 1: Anti-rno-miR-17-5p miScript miRNA inhibitor (0.1 or 1 nmol/pup)To confirm that IRE1α acts as a negative regulator of miR-17-5p under HI condition, we examined the miR-17-5p expression levels after IRE1α inhibition.

miR-17-5p inhibitor-0.1 or 1: Anti-rno-miR-17-5p miScript miRNA inhibitor (0.1 or 1 nmol/pup) To confirm that IRE1α acts as a negative regulator of miR-17-5p under HI condition, we examined the miR-17-5p expression levels after IRE1α inhibition.

ITo determine the effects of miR-17-5p overexpression or inhibition on infarct area, TXNIP expression, NLRP3 inflammasome activation, and IL-1β production after HI, miR-17-5p mimic or inhibitor was intracerebroventricularly injected at 48 h before HI.

To determine the effects of miR-17-5p overexpression or inhibition on infarct area, TXNIP expression, NLRP3 inflammasome activation, and IL-1β production after HI, miR-17-5p mimic or inhibitor was intracerebroventricularly injected at 48 h before HI.

Fig. 5IRE1α inhibition upregulated miR-17-5p expression post HI and.

b q-PCR results showed IRE1α inhibition upregulated mir-17-5p expression at 6 h after HI.

IRE1α inhibition upregulated miR-17-5p expression at 6 h post HI.

To choose effective dose of miR-17-5p mimic or inhibitor and assess the effect of miR-17-5p on TXNIP expression, negative control or Syn-rno-miR-17-5p miScript miRNA mimic or Anti-rno-miR-17-5p miScript miRNA inhibitor were injected intracerebroventricularly.

Conversely, anti-miR-17-5p inhibitor reversed IRE1α inhibition -induced decrease in TXNIP expression and inflammasome activation, as well as exacerbated brain injury after HI.

miR-17 is a member of the miR-17/92 cluster, one of so far, the best-studied microRNA clusters that codes six mature miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1. Members of this cluster are expressed in a variety of tissues and carry out essential functions both in normal development and in diseases.

TXNIP levels were remarkably up-regulated by introducing miR-17-5p inhibitor (1 nmol/pup) into pups (Fig.   5e, g); conversely, miR-17-5p mimic (0.5 nmol/pup) reduced baseline levels of TXNIP (Fig.   5d, f).

Li et al. found that miR-17 overexpression can upregulate autophagy to aggravate hepatic ischemia reperfusion injury [80].

STF-083010 treatment upregulated miR-17-5p expression at 6 and 24 h post HI, but statistical significant difference was observed only at the 6 h time point between the treatment and vehicle groups (P < 0.05, Fig.   5b).

Consistent with this notion, we found that level of miR-17-5p expression in the ipsilateral hemisphere reduced up to 24 h post HI insult and IRE1 RNase inhibition could rescue the miR-17-5p level drop that occurred at 6 h post HI.

Inhibition of IRE1α with STF-083010 exerts its neuroprotective effects via overexpression of miR-17-5p at 24 h post HI.

Conversely, anti-miR-17-5p inhibitor reversed IRE1 inhibition -induced decrease in NIRP3-TXNIP combination and inflammasome activation, as well as exacerbated brain injury after HI.

In addition, miR-17 plays a role in neurodegenerative diseases including Alzheimer’s disease and multiple sclerosis [74, 75].

miR-17-5p inhibitor reversed the effect of IRE1a inhibition on brain infarction after HI (raw data of quantitative analysis of infarct volume).

In the present study, we sought to investigate whether microRNA-17 (miR-17), a potential IRE1α ribonuclease (RNase) substrate, arbitrates downregulation of thioredoxin-interacting protein (TXNIP) and consequent NLRP3 inflammasome activation in the immature brain after HI injury and whether inhibition of IRE1α may attenuate inflammation via miR-17/TXNIP regulation.

Upregulated miR-17-5p provided neuroprotective effect on the neonatal HI pups.

TXNIP expression was regulated by miR-17-5p levels.

Interestingly, two binding sites identified in the TXNIP 3′-UTR might be targeted by miR-17 across multiple species, suggesting a possible critical role of miR-17 in regulation of TXNIP mRNA stability.

e, g The expression levels of TXNIP mRNA (e, n = 3) and protein (g, n = 4, * P < 0.05 compared with negative control or naive group) were increased at 48 h after administration of miR-17-5p inhibitor.

It has previously been known that TXNIP, as a binding partner to NLRP3, is essential for NLRP3 inflammasome activation and IL-1β production under oxidative stress and ER stress, raising the possibility that NLRP3 inflammasome activation is the downstream event of IRE1α -induced TXNIP upregulation through miR-17 after HI.

It has been experimentally confirmed that TXNIP acts as a direct target gene for miR-17 in β cells and senescent fibroblasts [25, 57].

It has been experimentally validated that TXNIP is a target gene for miR-17-5p [25, 57].

This considerable discrepancy is probably due to expressions and functions of miR-17/92 cluster depend on various contexts, cellular type, species, mo del system, and age.

A previous study indicated that serum miR-17-5p expression was elevated after acute ischemic stroke in the human adult.

To explore the mechanistic bases of IRE1α -mediated HI brain injury, we turned our attention to miR-17-5p, a candidate target of IRE1α’s endonuclease activity.

miR-17-5p miRNA mimic pretreatment suppressed elevated cleavage of caspase-1 (P < 0.01 vs.

The expression of miR-17-5p was normalized using U6 as the internal control.

IRE1a activation, through decay of miR-17-5p, elevated TXNIP expression to activate NLRP3 inflammasome and aggravated brain damage.

To explore miR-17-5p expression change in response to HI, reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) for miR-17-5p quantitation was conducted in ipsilateral/right hemisphere of each group at 3, 6, and 24 after HI insult (n = 4/time point).

Among the six members of miR-17/92 cluster, miR-17 is expressed ubiquitously and highly in all tissues detected, pointing to a generally high significance of this miRNA.

MiR-17-5p mimic or anti-miR-17-5p inhibitor was injected intracerebroventricularly at 48 h before HI.

Recently, it has been found that miR-17 could inhibit hypoxia -induced apoptosis in the kidneys, hearts, and pulmonary artery smooth muscle cells [76– 79].

At 48 h after administration of miR-17-5p mimic or inhibitor, the expression levels of TXNIP mRNA and protein were measured.

Furthermore, miR-17-5p mimic also inhibited NLRP3 binding to TXNIP and prevented NLRP3 inflammasome formation and activation, featuring with caspase-1 cleavage and IL-1β production.

Pups were randomly assigned into eight groups: sham, HI, negative control+HI, mir-17-5p mimic+HI, vehicle+HI, STF+HI, STF+negative control+HI, and STF+mir-17-5p inhibitor+HI (n = 12/group).

vehicle+HI group), while administration of anti-miR-17-5p miRNA inhibitor resulted in higher TXNIP level (P < 0.05 vs.

Brain tissue was harvested at 3, 6, and 24 h post HI, and expression levels of miR-17-5p were detected using qPCR.

Under irremediable ER stress, ribonuclease activity of IRE1α, one of the three sensors of UPR, initiates degeneration of miR-17, subsequently TXNIP mRNA becomes more stable to elevate TXNIP expression levels [28].

To experimentally establish this hypothesis, we first detected whether intervention of miR-17 expression changed IRE1α -induced TXNIP-NLRP3 binding by co-immunoprecipitation (Co-IP) studies.

TXNIP is a target of miR-17-5p.

a qPCR results showed the down-regulation of miR-17-5p in HI compared with naive group.

The expression of TXNIP was significantly (P < 0.01) increased post HI compared to sham, but miR-17-5pmiRNA mimic-administrated pups showed significantly (P < 0.01) reduced expression of TXNIP compared to HI or negative control+HI groups (Fig.   6c, d).

STF-083010 treatment ameliorates brain injury post HI, however the therapeutic effect was reversed by Anti-rno-miR-17-5p miScript miRNA inhibitor (P < 0.05 vs.

VTo explore miR-17-5p expression change in response to HI, reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) for miR-17-5p quantitation was conducted in ipsilateral/right hemisphere of each group at 3, 6, and 24 after HI insult (n = 4/time point).

STF-083010 treatment group showed less TXNIP protein binding with NLRP3, whereas administration of anti-miR-17-5p miRNA Inhibitor reversed this effect (Fig.   7g).

To evaluate the effect of IRE1α inhibition on miR-17-5p expression level, pups were randomly divided into three groups: sham (n = 4), vehicle+HI (n = 8), and STF+HI (n = 8).

Either Syn-rno-miR-17-5p miScript miRNA mimic or Anti-rno-miR-17-5p miScript miRNA inhibitor was administered into pups by ICV infusion 2 days before HI.

There is a widespread overexpression of miR-17 in diverse tumor subtypes including both hematopoietic and solid tumors [69– 73].

There are highly conserved seed sequences for miR-17 in the TXNIP 3′-UTR which are found to govern TXNIP mRNA expression at posttranscriptional level.

Anti-miR-17-5p miRNA inhibitor also attenuated this effect (Fig.   7c, f).

org, Release 7.1), we found that two binding sites identified in the TXNIP 3′-UTR might be targeted by miR-17-5p, a mature miR-17 in rats (Fig.   5c).

MiR-17-5p mimic administration ameliorated TXNIP expression, NLRP3 inflammasome activation, caspase-1 cleavage, and IL-1β production, as well as brain infarct volume.

It has been confirmed that miR-17 is a regulator of TXNIP mRNA stability.

The endogenous miR-17-5p level in the ipsilateral hemisphere at 3 h post HI injury showed a decrease in expression levels compared to naive and remained at a relatively low level (P < 0.05 vs.

d, f The expression levels of TXNIP mRNA (d, n = 3) and protein (f, n = 4, * P < 0.05 compared with negative control or naive group) were reduced at 48 h after administration of miR-17-5p mimic.

MiR-17-5p expression was reduced after HI, and this decrease was attenuated by STF-083010 treatment.

It has been confirmed that miR-17 plays a critical role on regulation of TXNIP mRNA stability in ER stress of β cells [23, 25].

Based on the above findings, we may reasonably speculate that the level of TXNIP might be regulated by IRE1 -mediated miR-17 decay and then control activation of NLRP3 inflammasome and release of inflammatory mediator after neonatal HI.

We next investigated whether the IRE1α regulated TXNIP expression through miR-17 post HI.

Du et al. Showed that miR-17 promoted cardiomyocyte apoptosis in response to ischemia followed by reperfusion [81].

Moreover, Lerner et al. also report IRE1α mediated destabilization of miR-17 in β cells [25].

Data from bioinformatic analysis showed the TXNIP 3′-UTR has two conserved binding sites for miR-17.

IRE1α activation, through degenerating miR-17-5p, stabilized TXNIP mRNA and amplified TXNIP level to activate NLRP3 inflammasome and deteriorate brain injury.

Based on previous studies, we hypothesized that IRE1α activation induces increased TXNIP level through decaying miR-17 to activate NLRP3 inflammasome thus deteriorating brain injury following neonatal HI.

These data suggest that miR-17-5p might be a potential effector in the IRE1 -induced UPR pathway after HI.

Thus, based on the above studies, we hypothesized that HI induced activation of IRE1 can degenerate miR-17 and exacerbate brain injury.

miR-17-5p mimic-0.05 or 0.5: Syn-rno-miR-17-5p miScript miRNA mimic (0.05 or 0.5 nmol/pup).

MiR-17 level drop increases TXNIP mRNA stability through post-transcriptional regulation.

Hypoxia–ischemia IRE1α MicroRNA-17 (miR-17) Neonatal Nod-like receptor protein 3 (NLRP3) Thioredoxin-interacting protein (TXNIP) Cerebral hypoxia–ischemia (HI) is a principal risk factor of perinatal brain injuries in both full-term and preterm neonates worldwide leading to acute mortality and chronic disability [1– 4].

However, there are some divergences of the role of miR-17 in hypoxia/ischemia -induced injuries presented by other research groups.

miR-17-5p mimic attenuated brain infarction after HI (raw data of quantitative analysis of infarct volume).

As shown in Fig.   6a, b, pups pretreated with Syn-rno-miR-17-5p miScript miRNA Mimic showed reduced infarct size in the brain (P < 0.01 vs.

IRE1α showed to alter TXNIP levels through miR-17 post HI.

The effect of changing miR-17-5p level on TXNIP in vivo was evaluated by injecting either syn-rno-miR-17-5p miScript miRNA Mimic or anti-rno-miR-17-5p miScript miRNA Inhibitor by intracerebroventricular (ICV) infusion.

c Sequence alignment showed putative miR-17-5p binding sites within the 3′-UTR of the TXNIP mRNA in rats.

Most functional studies of the miR-17/92 cluster focused on tumorigenesis, in which the cluster promotes proliferation and survival of tumor cells.

miR-17 played a role in IRE1a -mediated NLRP3 inflammasome activation and IL-1β production at 24 h post HI.

Hyperactivated IRE1α displays relaxed-specific RNase activity, initiating RIDD to degenerate miR-17, the TXNIP destabilizing microRNA.

In the present study, we sought to investigate the potential role of IRE1α/miR-17/TXNIP pathway in inflammasome activation and brain injury after HI insult and explore the potential therapeutic utility of IRE1α inhibitor in neonatal HI mo del.

MicroRNA-17 (miR-17) is a member of miR-17-92 cluster, located on the human chromosome 13 and on the mouse chromosome 14 [32].

Furthermore, it has been reported that miR-17 might be a substrate of RE1 -dependent decay (RIDD).

2

The results revealed that (1) h-ERG trafficking was impaired after prolonged period of oxidative stress; (2) chronic oxidative stress induced reciprocal changes of expression between miR-17-5p, along with several other miRNAs sharing the identical seed motif, and the ER stress-related chaperones (Hsp70/Hsc70, CANX, and Galga2), with the former upregulated and the latter downregulated; (3) miR-17-5p targets all these ER stress-related chaperones to cause defective trafficking of h-ERG; (4) Either upregulation of endogenous or application of exogenous miR-17-5p reduced h-ERG current density, and the effects were abolished by miR-17-5p inhibitor; and (5) sequestration of AP1 eliminated the upregulation of miR-17-5p and other members of the seed family, and meanwhile ameliorated impairment of h-ERG trafficking.

Furthermore, our study provided preliminary evidence for the role of AP1 in mediating oxidative stress -induced deregulation of miR-17-5p seed family miRNAs: inhibition of AP1 prevented upregulation of these miRNAs and consequently the downregulation of the chaperones was mitigated.

To construct reporter vectors bearing miR-17-5p target sites, we synthesized (by Invitrogen) fragments containing the exact target sites for miR-17-5p in the 3’UTRs of Hsp70, Hsc70, CANX, GOLGA2, or the mutated target sites, and inserted these fragments separately into the multiple cloning sites downstream the luciferase gene (HindIII and SpeI sites) in the pMIR-REPORTTM luciferase miRNA expression reporter vector (Ambion, Inc.

Collectively, we show here that chronic oxidative stress caused upregulation of the miR-17-5p seed family miRNAs, which in turn target the genes encoding the ER stress-related chaperones to downregulate these proteins, leading to defective trafficking and functional impairment of h-ERG channel proteins.

H-ERG trafficking was impaired by H [2]O [2] after 48 h treatment, accompanied by reciprocal changes of expression between miR-17-5p seed miRNAs and several chaperones (Hsp70, Hsc70, CANX, and Golga2), with the former upregulated and the latter downregulated.

These findings allowed us to reach the conclusion that deregulation of the miR-17-5p seed family miRNAs can cause severe impairment of h-ERG trafficking through targeting multiple ER stress-related chaperones, and activation of AP1 likely accounts for the deleterious upregulation of these miRNAs, after prolonged oxidative stress.

This effect was not seen in cells treated with the mutant miR-17-5p-I. Finally, our whole-cell patch-clamp recordings demonstrated that transfection of miR-17-5p suppressed h-ERG current (I [h-ERG]) in HEK293 cell with stable h-ERG expression, an effect reversed by co-transfection of miR-17-5p-I, but not by the mutant inhibitor (Figure 6).

We therefore proposed the following signaling pathway: chronic oxidative stress ― ER stress ― activation/upregulation of AP1 ― upregulation of miR-17-5p/other seed members ― repression of ER stress-related chaperones ― defective trafficking of h-ERG ― h-ERG current reduction ― QT prolongation.

This effect was not seen in cells treated with the mutant miR-17-5p-I. Finally, our whole-cell patch-clamp recordings demonstrated that transfection of miR-17-5p suppressed h-ERG current (I [h-ERG]) in HEK293 cell with stable h-ERG expression, an effect reversed by co-transfection of miR-17-5p-I, but not by the mutant inhibitor (Figure 6).

Collectively, deregulation of the miR-17-5p seed family miRNAs can cause severe impairment of h-ERG trafficking through targeting multiple ER stress-related chaperones, and activation of AP1 likely accounts for the deleterious upregulation of these miRNAs, in the setting of prolonged duration of oxidative stress.

Upregulation of miR-17-5p in turn downregulates the related chaperones to reduce h-ERG trafficking leading to associated electrical disturbance of the heart.

The downregulation caused by miR-17-5p was mitigated with co-transfection of miR-17-5p inhibitor (miR-17-5p-I), and mutant miR-17-5p-I failed to do so.

Upregulation of endogenous by H [2]O [2] or forced miR-17-5p expression either reduced h-ERG current.

This aberrant upregulation of the miR-17-5p seed family miRNAs is expected to produce powerful repression of their target genes.

miR-17-5p-I: miR-17-5p inhibitor (it was co -transfected with miR-17-5p mimic); MT miR-17-5p: mutant miR-17-5p; MT miR-17-5p-I: mutant miR-17-5p inhibitor.

We treated neonatal rat ventricular myocytes and HEK293 cells with stable expression of h-ERG with H [2]O [2] for 12 h and 48 h. Expression of miR-17-5p seed miRNAs was quantified by real-time RT-PCR.

These reciprocal changes of expression between the chaperones and miR-17-5p seed family members strongly suggest their targeting relationships.

miR-17-5p-I: miR-17-5p inhibitor (co -transfected with miR-17-5p mimic); MT miR-17-5p: mutant miR-17-5p; MT miR-17-5p-I: mutant miR-17-5p inhibitor.

Transfection of miR-17-5p in h-ERG -expressing HEK293 cells reduced the upper band (150 kDa) indicating the defective trafficking without altering the lower band for the total expression level of h-ERG proteins (Figure 5a).

Reciprocal changes of expression between miR-17-5p and ER stress-related chaperones after chronic oxidative stress in h-ERG -expressing HEK293 cells.

0084984.g003 Figure 3miR-17-5p-I: miR-17-5p inhibitor (it was co -transfected with miR-17-5p mimic); MT miR-17-5p: mutant miR-17-5p; MT miR-17-5p-I: mutant miR-17-5p inhibitor.

To experimentally establish the chaperones as cognate target genes for miR-17-5p, we treated cells h-ERG -expressing HEK293 cells with miR-17-5p mimic.

Direct effects of miR-17-5p on h-ERG trafficking in h-ERG -expressing HEK293 cells.

Indeed, in our experiments, though we were primarily focused on miR-17-5p alone, the antisense inhibitor knocked down all members of the miR-17-5p seed family, as they share tremendous sequence homology (Figure S7 in File S1).

To explore the possible role of AP1 in the concurrent upregulation of the miR-17~92 cluster and its two paralogs, we first confirmed the nuclear translocation of AP1 in cells exposed to H [2]O [2] (Figure 7a).

More notable is the finding that in addition to miR-17-5p, other miRNAs with identical seed motif as miR-17-5p were also upregulated after prolonged exposure to H [2]O [2].

Most intriguingly, a recent study showed that miR-17-5p regulates endocytic trafficking through targeting four trafficking-related proteins (TBC1D2, M6PR, ASAP2 and LDLR) in HeLa cells [50].

Sequestration of AP1 by its decoy molecule eliminated the upregulation of miR-17-5p, and ameliorated impairment of h-ERG trafficking.

QRT-PCR confirmed the downregulation of the miR-17-5p seed family miRNAs (Figure 7b), along with C13orf25 and MCM7 (Figure 7c), the host genes for the miR-17~92 cluster and the miR-106b~25 cluster, respectively.

During the early phase of H [2]O [2] insult (12 h), the chaperones were upregulated and miR-17-5p remained unaltered.

To understand how the miR-17-5p seed family miRNAs belonging to different clusters were simultaneously upregulated after prolonged period of oxidative stress, we analyzed the promoter regions of these three clusters.

Activation of AP1 by oxidative stress may be an upstream molecular mechanism for the upregulation of miR-17-5p.

Strikingly, the chaperones Hsp70/Hsc70 and CANX that had been documented to be regulators of h-ERG trafficking and Galga2 were all found to be target genes for miR-17-5p in this study.

miR-17-5p (5’-C AAAGUGCUUACAGUGCAGGUAG -3’; boldface letters indicate the seed motif), mutant miR-17-5p (5’-C AccccGCUUACAGUGCAGGUAG -3’; lowercase letters indicate nucleotides replacement mutation), its antisense oligonucleotides inhibitor miR-17-5p-I (5’-CUACCUGCACUGUAAGCACUUUG-3’), and mutant antisense (5’-CUACCUGCACUGUAAGCggggUG-3’) were synthesized by Integrated DNA Technologies Inc (IDT).

As expected, the mutant miR-17-5p had no effects on luciferase activities, and the mutant inhibitor did not alter the effects of miR-17-5p.

Experimental verification of Hsp70, Hsc70, CANX, and Golga2 as target genes of miR-17-5p by Western blot analysis in neonatal rat ventricular myocytes (NRVMs).

Figure 4a shows substantial reduction of luciferase activities in cells transfected with miR-17-5p, an effect reversed by its antisense inhibitor.

Application miR-17-5p inhibitor rescued H [2]O [2] -induced impairment of h-ERG trafficking.

AP1 Activation Underlies MiR-17-5p Upregulation and H-ERG Trafficking Impairment.

Hsp40 was used as a negative control for the target chaperones, and MT miR-17-5p and MT miR-17-5p-I were used as negative controls for miR-17-5p.

There was reciprocal relationship between miR-17-5p and these chaperones in terms of their expression after long-term treatment of H [2]O [2].

miR-17-5p-I: miR-17-5p inhibitor (co -transfected with miR-17-5p mimic); MT miR-17-5p: mutant miR-17-5p.

Similar reciprocal changes of expression between the chaperones and miR-17-5p seed miRNAs were consistently observed in NRVMs (Figure S6 in File S1).

And this reciprocal change of expression between the chaperones and miR-17-5p occurred only after prolonged period (48 h) of oxidative stress.

We established these chaperones as targets for miR-17-5p.

NRVMs and h-ERG expressing HEK293 cells were transfected with miR-17-5p (10 nmol/L), mutant miR-17-5p (10 nmol/L), miR-17-5p-I (4 nmol/L), or mutant miR-17-5p-I (4 nmol/L), with lipofectamine 2000 (Invitrogen), according to manufacturer’s instructions.

Application of miR-17-5p mimic, but not the mutant construct, decreased the levels of these proteins, which was readily reversed by the specific inhibitor of this miRNA.

Moreover, treatment with H [2]O [2] for 48 h substantially reduced I [h-ERG], and this effect was eliminated by miR-17-5p-I, indicating the role of miR-17-5p in suppressing the current.

We began with expression of miR-17-5p and other members of this seed family in HEK293 cells, using quantitative real-time RT-PCR.

This study plus the present study indicate that miR-17-5p is a trafficking protein regulator miRNA.

Our computational analysis predicted AP1 (c-jun/c-fos), a well-known transactivator of many genes, as a common regulator of transcription of the miR-17~92 cluster and its two paralogs.

Construction of Chimeric MiR-17-5p-Target Site–Luciferase Reporter Vectors.

Hence, miR-17-5p seed family miRNAs may be considered a new target for antiarrhythmic therapy.

We unexpectedly identified miR-17-5p, along with other miRNAs (miR-20a and b, miR-106a and b, and miR-93) sharing the same seed motif as miR-17-5p, as a potential common regulator of Hsp70, Hsc70, CANX, and Golga2 (Figures S2-S5 in File S1).

Experimental verification of Hsp70, Hsc70, CANX, and Golga2 as target genes of miR-17-5p by luciferase reporter gene activity assay in HEK293 cells.

We then verified the ability of miR-17-5p-I to knockdown miR-17-5p (Figure 4b).

MiR-17-5p Targets Multiple ER Stress-Related Chaperones.

As depicted in Figure 3, transfection of miR-17-5p reduced the protein levels of Hsp70, Hsc70, CANX, and Golga2, but not that of Hsp40 as a negative control.

It appears plausible that oxidative stress triggers AP1 activation, which then transcriptionally activates all three miRNA clusters harboring miR-17-5p seed miRNAs.

0084984.g004 Figure 4(a) Evaluation of effects of miR-17-5p on luciferase activities elicited by chimeric 3’UTR—luciferase vector to verify the interaction between miR-17-5p and the target sites of the ER stress-related chaperones.

Furthermore, in cells exposed to H [2]O [2] for 48 h and concordantly treated with miR-17-5p-I, the impairment of h-ERG protein was remarkably relieved (Figure 5b).

This cluster has two paralogs, miR-106a~363 (miR-106a, miR-18b, miR-19b-2, miR-20b, miR-92a-2 and miR-363, located on the X chromosome) and miR-106b~25 (miR-106b, miR-93, and miR-25, located on human chromosome 7), which are located on different chromosomes but contain individual miRNAs that are highly similar to those encoded by the miR-17~92 cluster [36, 37].

0084984.g005 Figure 5(a) Effects of exogenously applied miR-17-5p mimic on h-ERG trafficking assessed by Western blot analysis.

The mutant miR-17-5p failed to affect h-ERG trafficking and the mutant miR-17-5p-I was unable to affect the rescuing effect of miR-17-5p-I. 10.1371/journal.

The mutant miR-17-5p failed to affect h-ERG trafficking and the mutant miR-17-5p-I was unable to affect the rescuing effect of miR-17-5p-I. 10.1371/journal.

The human miR-17~92 cluster is located in the third intron of a ~7 kb primary transcript known as C13orf25 or MIR17HG1, a non-coding RNA.

MiR-17-5p belongs to the miR-17~92 cluster, located on the human chromosome 13q31, and is a prototypical example of a polycistronic miRNA gene encoding six miRNAs (miR-17-5p, miR-18, miR-19a, miR-19b, miR-20 and miR-92).

0084984.g006 Figure 6Effects of miR-17-5p on h-ERG current (I [h-ERG]) recorded using whole-cell patch-clamp techniques.

To construct reporter vectors bearing the promoter regions containing the putative cis-acting elements for AP1 of miR-17~92, miR-106a~363, and miR-106b~25 cluster genes, we PCR synthesized (by Invitrogen) fragments of 800 bp upstream the transcription start sites of these genes.

Co-application of miR-17-5p-I rescued the trafficking disturbance.

This prompted us to exploit the relationships between miR-17-5p and the chaperones.

Effects of activating protein-1 (AP1) on transcriptional stimulation of the miR-17-5p seed miRNAs belonging to miR-17~92, miR-106a~363, and miR-106b~25 clusters in HEK293 cells.

As expected, this miR-17-5p-I also decreased the levels of other miR-17-5p seed family miRNAs, as they share high sequence homology (Figure S7 in File S1).

Our data demonstrated the ability of AP1 decoy to mitigate the luciferase activities driven by the promoters of the miR-17~92 cluster and its two paralogs (Figure 7d).

Effects of miR-17-5p on h-ERG current (I [h-ERG]) recorded using whole-cell patch-clamp techniques.

The mutant miR-17-5p did not produce any significant alterations of these proteins.

Nonetheless, our data showing qualitatively the same changes of miR-17-5p (and other seed members) and the chaperones (Hsp70/Hsc70, CANX, and Golga2) would suggest that cardiomyocytes and HEK293 cells have similar response to oxidative stress.

3

In conclusion, we demonstrate that Sal B down-regulates miR-17-5p expression, leading to the restoration of WIF1 and the inhibition of Wnt/β-catenin signaling, which contributes to the suppression of activated HSCs.

Figure 7 Sal B induces miR-17-5p down-regulation, WIF1 up-regulation, the inactivation of Wnt pathway, resulting in the inhibition of the activated HSCs.

Our results not only provide a new insight of the role of miRNA-activated Wnt/β-catenin signaling in liver fibrosis, but also show a new anti-fibrotic mechanism of Sal B. Sal B induces miR-17-5p down-regulation, WIF1 up-regulation, the inactivation of Wnt pathway, resulting in the inhibition of the activated HSCs.

Moreover, emerging studies show that miR-17-5p over -expression promotes HCC development and the inhibition of miR-17-5p results in the suppression of HCC proliferation and migration [29, 30].

Given that WIF1 was predicted as a putative target of miR-17-5p (Figure 5A and Figure 5B), we hypothesized that miR-17-5p might promote hepatic fibrosis via inhibiting WIF1 expression.

Figure 3HSC-T6 cells and primary HSCs were transfected with miR-17-5p mimics or miR-NC for 48 h. A. The down-regulation of miR-17-5p expression was found in CCl [4] -treated rats, HSC-T6 cells and primary HSCs after Sal B treatment.

HSC-T6 cells and primary HSCs were transfected with miR-17-5p mimics or miR-NC for 48 h. A. The down-regulation of miR-17-5p expression was found in CCl [4] -treated rats, HSC-T6 cells and primary HSCs after Sal B treatment.

revealed that compared with the control, miR-17-5p inhibitor suppressed a proportion of cells in the S phase and increased the number of cells in the G0/G1 phase, suggesting that miR-17-5p inhibitor contributed to the inactivation of HSCs (Figure 3E).

Notably, the inhibition of miR-17-5p suppressed CCl [4] -induced liver fibrosis.

These data revealed that Sal B suppresses HSC activation, at least in part, through inhibiting miR-17-5p-activated Wnt/β-catenin pathway.

C. The HSCs were transfected with pMIR (empty vector), pMIR containing miR-17-5p targeting sequence (pMIR-17-5p) and pMIR with miR-17-5p mutated target sequence (pMIR-17-5p-Mut).

The lentiviral vector containing negative control (Lenti-NC) and lentiviral miR-17-5p inhibitor (Lenti-miR-17-5p -inhibitor) were obtained from Shanghai GeneChem.

All these results indicated that the reduction of miR-17-5p level in the treatment of Sal B contributed to the suppression of activated HSCs and miR-17-5p promoted the activation of Wnt/β-catenin pathway via inhibiting WIF1 level.

Notably, as shown in H&E and Masson staining, miR-17-5p inhibitor treatment significantly suppressed liver fibrosis caused by CCl [4] (Figure 4A).

Our previous study showed that WIF1 was a direct target of miR-17-5p and the levels of miR-17-5p were reduced by Sal B in HSCs.

All these results suggested that miR-17-5p could promote the activation of HSCs via the down-regulation of WIF1.

To further investigate whether WIF1 is the direct downstream target of miR-17-5p, the sequence of 3′UTR of WIF1 mRNA target region was cloned into pMIR-REPORT [TM] Luciferase plasmid (Figure 5A and Figure 5B).

The silencing of WIF1 blocked down the anti-fibrotic effects of Sal B and WIF1 was a direct target of miR-17-5p.

MiR-17-5p activated HSCs via Wnt/β-catenin pathwayOur previous study showed that WIF1 was a direct target of miR-17-5p and the levels of miR-17-5p were reduced by Sal B in HSCs.

Furthermore, miR-17-5p was involved in the regulation of cell cycle and inhibited the effects of Sal B on cell proliferation.

These results confirmed that WIF1 was a direct target of miR-17-5p.

MiR-17-5p inhibitor treatment significantly suppressed rat liver fibrosis caused by CCl [4].

Recently, miR-17-5p, a member of the miR-17-92 cluster, is often up-regulated in many malignancies including hepatocellular carcinoma (HCC) and functions as an oncogenic miRNA [13, 14].

Herein, we demonstrated that WIF1 is a new target of miR-17-5p.

We found that the levels of desmin (green) and α-SMA (red) were increased by miR-17-5p over -expression (Figure 3B).

E. Effect of WIF1 siRNA on the cell cycle in HSCs transfected with miR-17-5p inhibitor.

Our previous study demonstrated that over -expression of miR-17-5p promotes HSC proliferation and activation [16].

HSC-T6 cells and primary HSCs were transfected with miR-17-5p mimics for 48 h and treated with Sal B for additional 48 h. A. The mRNA expressions of WIF1, α-SMA and Col1A1 were analyzed by real-time PCR.

C. The mRNA expression of WIF1 was analyzed by real-time PCR in HSCs treated with miR-17-5p mimics.

B. The levels of α-SMA were analyzed by immunohistochemistry in CCl [4] -treated rats after miR-17-5p inhibitor treatment.

The primary HSCs were transfected with miR-17-5p inhibitor for 48 h and then transfected with WIF1 siRNA for an additional 48 h. Each value is the mean ± SD of three experiments.

All the data suggest that miR-17-5p over -expression contributes to the activation of HSCs, which is also consistent with our previous study [16].

Taken together, our data suggested that the activation of HSCs was suppressed by Sal B via miR-17-5p and WIF1 (Figure 7).

In this study, miR-17-5p over -expression increased the levels of α-SMA and desmin in primary HSCs.

Immunohistochemical results additionally confirmed that the levels of α-SMA increased in CCl [4] -treated rats were attenuated by miR-17-5p inhibitor treatment (P < 0.05, Figure 4B).

Rats were treated with olive oil (n = 6), CCl [4] (n = 6), CCl [4] plus Lenti-NC (n = 6) and CCl [4] plus Lenti-miR-17-5p -inhibitor (n = 6).

Lenti-miR-17-5p -inhibitor or Lenti-NC was injected via the tail vein only once at three weeks after CCl [4] injection (1×10 [9] transducing unit/rat).

We also examined the effects of miR-17-5p inhibitor and the silencing of WIF1 on cell cycle.

However, the mechanism of the direct regulation of miR-17-5p by Sal B still remains unclear and further studies are warranted.

However, the effects of miR-17-5p inhibitor on cell cycle were blocked down by WIF1 siRNA (Figure 3E).

In this study, we found that Wnt/β-catenin pathway was attenuated by Sal B via restoration of WIF1 and inhibition of miR-17-5p, with a reduction in TCF activity and an increase in P-β-catenin level.

B. Predicted consequential pairing of the target region and miR-17-5p.

D. The protein expression of WIF1 was analyzed by western blotting in HSCs treated with miR-17-5p mimics.

miR-17-5p over -expression promoted the activation of HSCs and contributed to the reduction of WIF1 levels.

For example, Li et al. found that miR-17-5p is able to enhance cell proliferation by promoting G1/S transition of the cell cycle and suppressing apoptosis in ovarian cancer cell lines [28].

Meanwhile, the luciferase activities of mutated type WIF1 3′UTR and empty vector were not inhibited by miR-17-5p precursor (Figure 5C).

Figure 6HSC-T6 cells and primary HSCs were transfected with miR-17-5p mimics for 48 h and treated with Sal B for additional 48 h. A. The mRNA expressions of WIF1, α-SMA and Col1A1 were analyzed by real-time PCR.

WIF1 is a target of miR-17-5p.

[#] P < 0.05 compared with miR-17-5p inhibitor group.

To investigate the effects of miR-17-5p over -expression on the activation of HSCs, immunofluorescence staining for α-SMA and the HSC marker desmin was examined in primary HSCs.

C. The reduction of TCF activity induced by Sal B was restored by miR-17-5p mimics.

D. The reduction of cell proliferation induced by Sal B was restored by miR-17-5p mimics.

Roles of miR-17-5p in the anti-fibrotic effects induced by Sal B. DISCUSSION.

Black box indicates miR-17-5p and a tested sequence indicates the region that was inserted into the luciferase reporter vector.

Moreover, the reduction of TCF activity and cell proliferation rate induced by Sal B were almost blocked down by miR-17-5p mimics (Figure 6C and Figure 6D).

Cells were seeded in a 96-well plate at a density of 1×10 [3] cells per well, then cells were transfected with miR-17-5p mimics and miR-NC as described above.

Then, medium was replaced with Opti-MEM (Invitrogen, USA) and cells were transfected with miR-17-5p mimics (60 nM) and miR-NC (60 nM) (GenePharma, China) using Lipofectamine 2000 for 48 h. After 6 h of transfection, the medium was replaced with DMEM containing 10 % FBS.

Notably, elevated serum miR-17-5p has also been reported to correlate with the poor prognosis in HCC patients [31].

We previously showed that miR-17-5p promotes HSC proliferation and activation, at least in part, via reduction of Smad7 [16].

Notably, increased WIF1 levels in Sal B -treated cells were additionally reversed by miR-17-5p mimics.

The results showed that only miR-17-5p was reduced in vivo and in vitro after Sal B treatment (Figure 3A and Supporting Information Figure S1).

Interaction of miR-17-5p with the 3′UTR of WIF1.

As a result, miR-16, miR-17-5p, miR-20a, miR-20b-5p, miR-21 and miR-199-5p were extracted as candidates.

To our knowledge, this is the first report to show that miR-17-5p-activated Wnt/β-catenin pathway is involved in the effects of Sal B. MiR-17-5p was described as an oncogenic miRNA in cancers.

The effects of Sal B on the levels of P-β-catenin, α-SMA and type I collagen were attenuated by miR-17-5p mimics (Figure 6A and Figure 6B).

The results showed that both the mRNA and protein levels of WIF1 were reduced by miR-17-5p mimics (Figure 3C and Figure 3D).

MiR-17-5p is not only involved in cell functions such as proliferation and migration but also a key regulator of the G1/S phase cell cycle transition [15].

WIF1 3′UTR for miR-17-5p forward, 5′-TCGAGTTACGCCGAGTTCAC-3′ and reverse, 5′-GTTTCGCCTCTCTAGGGCTC-3′.

These data indicated that miR-17-5p promoted the activation of HSCs.

In addition, it was found that all the anti-fibrotic effects of Sal B could be blocked down by miR-17-5p mimics.

It also shows cotransfection of miR-17-5p precursor or miR-NC.

Next, the mRNA and protein levels of WIF1 were examined in cells transfected with miR-17-5p mimics.

Therefore, miR-17-5p was selected for further experiments.

The construct was cotransfected into HSCs along with miR-17-5p precursor or miRNA negative control (miR-NC).

4

AIB1 expression was downregulated by miR-17-5p by translational inhibition, and the expression of miR-17-5p was low in breast cancer cell lines.

markedly at 48 h. In addition, at 24 and 48 h. The protein expression of Cyclin D1, p-Akt and Akt in glioma C6 cells decreased after transfection with miR-17 mimics for 72 h, and increased after transfection with miR-17 inhibitor for 72 h. The reduced miR-17 levels in glioma cells increased cell viability and migration, which correlates with increased expression of Cyclin D1, p-Akt and Akt.

The relative protein expression of Cyclin D1, p-AKT and AKT in miR-17 inhibitor group to Lipofectamine control group was 1.3 ± 0.1, 1.9 ± 0.0, and 1.4 ± 0.0, respectively.

Protein expression of Cyclin D1, p-AKT and AKT increased in miR-17 inhibitor -transfected glioma C6 cells.

Mir-17-5p Regulates Breast Cancer Cell Proliferation by Inhibiting Translation of AIB1 mRNA.

We have demonstrated that the expression of miR-17 is decreased in glioma cells, and inhibition of miR-17 increased the viability and migration of glioma cells.

MiR-17/20 overexpression was reported to sensitize cells to apoptosis induced by either Doxorubicin or UV irradiation in breast cancer cells via Akt, and miR-17/20 mediated apoptosis via increased p53 expression which promoted the degradation of Akt [16].

Targeted miRNA sequences were shown as following: rno-miR-17-5p mimics: sense: 5’CAAAGUGCUUACAGUGCAGGUAG3’, antisense: 5’ACCUGCACUHUAAGCACUUUGUU3’, rno-miR-17-5p inhibitor: CUACCUGCACUGUAAGCACUUUG.

The expression of miR-17 was detected by quantitative PCR, and expression of Cyclin D1 was examined by Western Blot.

The expression of miR-17 was decreased in breast cancer cell line, and gene expression of Cyclin D1 decreased after lentiviral transduction of miR-17 to breast cancer cells [15].

The miR-17 microRNA (miRNA) precursor family is a group of small non-coding RNA genes that regulate gene expression, and it includes miR-20a/b, miR-93 and miR-106a/b.

After glioma C6 cells were transfected with inhibitor of miR-17 (200 nM) for 72 h, the protein expression of Cyclin D1 (p < 0.05), p-AKT (p < 0.001) and AKT (p < 0.01) increased compared to Lipofectamine and negative control groups (Fig 8).

In addition, protein expression of Cyclin D1, p-Akt and Akt in MiR-17 mimics or inhibitor -transfected glioma C6 cells was detected by Western Blot.

Therefore, it is possible that MiR-17 also targets the 3' UTR of Cyclin D1 gene in glioma cells, and decreased the protein expression of Cyclin D1 as shown in current study.

The expression of miR-17 was significantly lower, whereas the expression of Cyclin D1 was significantly higher in glioma C6 cells compared to normal brain tissue.

The expression of miR-17 was significantly lower (p < 0.01; Fig 1), and the protein expression of Cyclin D1 was markedly higher in rat glioma C6 cells compared to normal brain tissue (p < 0.001; Fig 2).

After glioma C6 cells were transfected with inhibitor of miR-17 (200 nM) for 72 h, the protein expression of Cyclin D1, Akt and p-Akt increased compared to Lipofectamine and negative control groups.

Protein expression of Cyclin D1, p-Akt and Akt increased in miR-17 mimic -transfected rat glioma C6 cells.

This indicated that miR-17 has a role as a tumor suppressor in glioma cells, and decreased miR-17 renders glioma cells unrestrained proliferation and metastasis.

Therefore, we aimed to explore effects of miR-17 mimics or inhibitor on the viability and migration of rat glioma C6 cells, and investigate possible mechanisms by examining protein expression of cyclin D1, p-Akt and Akt in current study.

The expression of miR-17 was detected by quantitative PCR.

The relative protein expression of Cyclin D1, p-AKT and AKT in miR-17 mimic group to Lipofectamine control group was 5.8 ± 0.6%, 41.5 ± 2.1%, and 70.3 ± 4.4%, respectively.

Expression of miR-17 and Cyclin D1 in rat glioma C6 cells.

We also showed that low miR-17 levels in glioma cells correlated with increased expression of active p-Akt and Akt.

Protein expression of Cyclin D1, p-Akt and Akt decreased in miR-17 mimic -transfected rat glioma C6 cells.

This provides another explanation for the increased viability and migration in glioma cells with low expression of miR-17.

In current study, we unveiled that inhibition of miR-17 increased the viability and migration of glioma cells.

The expression of miR-17 in rat glioma C6 cells and normal brain tissue was detected by quantitative PCR.

The miR17 mimics and inhibitors purchased from GenePharm.

Protein expression of Cyclin D1, p-AKT and AKT decreased in miR-17 mimics -transfected glioma C6 cells.

This provides one explanation for the increased viability and migration in glioma cells with low expression of miR-17.

Relative expression of miR-17 in rat glioma C6 cells and normal brain tissue.

In addition, we revealed that decreased miR-17 in glioma cells correlated with increased expression of Cyclin D1.

Thus, miR-17 may degrade Akt by increasing the expression of p53 in gliomas.

Our results reveal that miR-17 has a role as a tumor suppressor in glioma cells.

0190515.g001 Fig 1The expression of miR-17 was detected by quantitative PCR.

In conclusion, we demonstrated for the first time that the low miR-17 levels in glioma cells increased cell viability and migration, which correlates with increased expression of Cyclin D1, p-Akt and Akt.

showed that the expression of miR-17 was significantly lower in rat glioma C6 cells compared to normal brain tissue.

MiR-17 inhibitor increased the migration of glioma C6 cells.

The activating mutations of miR-17 were also revealed in human non-Hodgkin's lymphoma and T cell leukemia [6, 7].

Glioma C6 cells were transfected with MiR-17 mimics or inhibitor.

MiR-17 inhibitor increased the viability of glioma C6 cells.

MiR-17 was shown to target the 3' UTR of Cyclin D1 gene in breast cancer cells with the highest score using bioinformatics analyses.

Moreover, deletion of the miR-17 cluster has been shown to be lethal and result in developmental defects of lung and lymphoid cell in mice [9].

MiR-17 inhibitor increased the viability and migration of glioma C6 cells.

The current study aimed to investigate effects of miR-17 mimics or inhibitor on the viability and migration of rat glioma C6 cells, and explore possible mechanisms.

We identify miR-17 as an attractive molecule that can possibly be used as a biomarker to diagnose gliomas early and predict the prognosis, and current study provides the rationale for therapeutic approaches to enhance miR-17 in glioma cells.

Lower level of miR-17 in gliomas may correlate with worse prognosis.

Relative cell viability in different groups to the control group at 24 h was presented in Fig 5. MiR-17 inhibitor (200 nM) markedly increased the viability (1.5 ± 0.0 versus 1.4 ± 0.0, p < 0.05; Fig 5) and migration of glioma C6 cells (24 h: 0.86 ± 0.0 versus 1.2 ± 0.0, p < 0.05; 48 h: 0.90 ± 0.1 versus 1.3 ± 0.0, p < 0.05; Fig 6) compared to Lipofectamine control group.

Therapeutic approaches to increase miR-17 levels may have potential in treating gliomas.

MiR-17 miRNAs are produced from several miRNA gene clusters.

The oncogenic potential of miR-17 gene clusters was first identified in mouse viral tumorigenesis screens [5].

However, it is unclear about the role of miR-17 in glioma cells.

The results indicated that miR-17 was negatively correlated with Cyclin D1.

Studies have revealed that miR-17 involves in several types of tumors, and effects of miR-17 on tumors vary depending on cells and tissue involved.

5

When inhibit miR-17 in TNF-α-stimulated PDLSCs, protein expression level of osteogenic marker alkaline phosphatase (ALP) was downregulated (Fig.   3c).

According to previous results in our lab, overexpression of miR-17 decreased expression levels of osteogenic markers and bone matrix formation, inhibition of miR-17 alone increased osteoblast marker genes, suggesting that miR-17 is a negative regulator of osteogenic differentiation in H-PDLSCs [3].

Furthermore, inhibition of miR-17 by anti-miR-17 oligonucleotides (si-miR-17) resulted in the upregulation of the protein expression level of HDAC9 (Fig.   3d).

Interestingly, downregulation of HDAC9 by si-HDAC9 in P-PDLSCs restored the expression of pri-miR-17-92a as well as the mature miR17-92a, though, miR-18 was not affected, suggesting that HDAC9 inhibited miR17-92a (Fig.   3a, b).

miR17-92a cluster is first described in 2001 [20] in mammalians, known as tissue-specific expressed onco-miR, forms signaling loop with myc protein, miR17-92a regulates more than a hundred targets involved in proliferation depending on different cellular context, their role in affecting the HDAC, which is responsible for the global proliferation inhibition remains unknown [21].

Consistent with these results, in the current study, Alizarin red staining showed that downregulation of miR-17 inhibited calcified nodule formation in TNF-α-stimulated H-PDLSCs (Fig.   3f).

ChIP experiments revealed the promoter region of miR-17-92a HDAC9 enrichment in P-PDLSC samples, suggesting that HDAC9 inhibits the expression of miR17-92a by direct deacetylation (Fig.   3e).

miR-17 in periodontal ligament stem cells targets the 3′ untranslated regions of a Smad ubiquitin regulatory factor one(Smurf1), which when activated under chronic inflammation, would lead to increased degradation of various osteoblast-specific factors [3].

We demonstrated that the inhibition of HDAC by NaB downregulated miR17-92a family and partially rescued inflammation impaired osteogenesis in vitro and in vivo.

Comparison of the protein expression level of ALP (c) and HDAC9 (d) between P-PDLSCs and miR-17 inhibitor -treated P-PDLSCs.

The miRNAs clusters, miR-17-92a, miR-106b-25, and miR-106a-363, have been found to control EZH2 expression, which is involved in H3K27me3 -mediated tumor suppressor genes in cancer [32].

Furthermore, simultaneous addition of si-miR-17 and NaB inhibited osteogenesis to a similar extent than using si-miR17 alone in TNF-α-stimulated H-PDLSCs, suggesting that the rescue of osteogenesis by NaB largely depended on the expression of miR-17 (Fig.   3f).

When HDAC9 is inhibited by HDI, miR-17 has an inhibitory role in osteogenesis of PDLSC (data not shown).

The expression of pri-miR-17~92a was downregulated in P-PDLSCs compared to H-PDLSCs (Fig.   3a).

In our study, we showed that miR-17 is a new member of the epi-miRNA which inhibited the protein expression level of HDAC9.

In the physiological conditions, miR-17 as well as HDAC9 forms an inhibitory balance to regulate the differentiation of PDLSCs and affect adjacent cells to regulate bone formation.

Fig. 6 The mutual inhibition between HDAC9 and miR-17 in P-PDLSCs regulates the osteogenesis of PDLSCs and affects the bone regeneration in inflammatory condition a Schematic illustration of the LPS -induced periodontitis mo del in SD rats.

miR-17 and HDAC9 negatively inhibit each other in regulation of osteogenic differentiation of PDLSCs in vitro.

mir-17 and HDAC9 negatively inhibit each other in regulation of osteogenic differentiation of PDLSCs in vitro.

Fig. 6 The mutual inhibition between HDAC9 and miR-17 in P-PDLSCs regulates the osteogenesis of PDLSCs and affects the bone regeneration in inflammatory condition Since adult stems cells have long been recognized as a critical population in restoring tissue function under inflammatory conditions, we asked if inflammation affects PDLSCs, the adult stem cells from periodontal ligament tissue and what specific effects has inflammation brought to PDLSCs.

We further complement the story of HDAC9 and MSC by first identifying HDACs expression in PDLSC and finding that HDAC9 participates in osteogenic differentiation through interacting with miR-17 to repress RUNX2 transcription.

According to our results, the overall role of miR-17 is likely to be closely associated with the expressional level of HDAC9.

Fig. 3 a Comparison of the RNA expression level of pri-miR17-92a cluster between H-PDLSCs, P-PDLSCs, and si-HDAC9 -treated P-PDLSCs.

miR-17 induced osteogenesis of inflamed periodontal adult stem cell through inhibition of HDAC9.

f Analysis of calcified nodules by Alizarin red staining in NaB, si-miR-17, or NaB plus si-miR-17 -treated TNF-α-stimulated PDLSCs In order to find out if miR-17 plays important role in the inhibitory loop in osteogenesis of PDLSCs, we examined the effects of miR-17 on osteogenesis of PDLSCs.

Finally, we revealed that the rescue of osteogenesis by HDAC inhibitor depended on miR-17.

Taken together, the miR-17 and HDAC9 formed inhibitory loop under inflammatory conditions.

Interestingly, the role of miR-17 in PDLSC differentiation can be shifted to either promotion of osteogenesis or inhibition of osteogenesis [16].

f Analysis of calcified nodules by Alizarin red staining in NaB, si-miR-17, or NaB plus si-miR-17 -treated TNF-α-stimulated PDLSCs a Comparison of the RNA expression level of pri-miR17-92a cluster between H-PDLSCs, P-PDLSCs, and si-HDAC9 -treated P-PDLSCs.

b Comparison of the RNA expression of mature miR-17-92a between P-PDLSCs and si-HDAC9 -treated P-PDLSCs.

This may explain why a co-inhibit relationship is needed between HDAC9 and miR-17.

Inhibition of HDAC by NaB as well as si-miR-17 rescues osteogenesis of the human inflammatory PDLSCs.

Statistical quantification of RUNX2 and OCN signal (right panel) The mutual inhibition between HDAC9 and miR-17 in P-PDLSCs regulates the osteogenesis of PDLSCs and affects the bone regeneration in inflammatory condition One of the key characteristics of chronic inflammation is its persistence.

In previous studies, miR-17 promotes proliferation in the regulation of B cell lymphoma growth and retinoblastoma, and thus might delay differentiation 15, 26.

Furthermore, miR-17 became a positive regulator of osteogenic differentiation in P-PDLSCs [3].

These evidences prompt us to verify that if miR-17-92a could regulate HDAC modulated dental tissue differentiation under inflammatory conditions.

Furthermore, the transcription of miR-17 itself is regulated via deacetylation by HDAC9 in the promoter regions under inflammatory conditions.

miR-17 is essential for NaB to rescue the osteo-differentiation of TNF-α-stimulated PDLSCs.

We found a new epi-miRNA, the miR-17, which forms a reciprocal signaling loop with HDAC9 in PDLSCs under inflammation condition.

However, the mechanisms underlying the shift of the role of miR-17 in osteogenesis needed further exploration.

mir-17 and HDAC9 negatively affect each other under chronic inflammatory conditions in the adult stem cell in tooth tissue.

e Analysis of the enrichment of HDAC9 protein at the pri-miR-17-92a cluster promoter region by Chromatin Immunoprecipitation (ChIP).

We first examined the association of HDAC9 with miR-17~92a in PDLSCs of periodontitis patients.

This is surprising since HDAC9 promotes proliferation and miR-17~92a belongs to the onco-miR family.

Schematic illustration of the relationship between HDAC9, miR-17, and bone regeneration.

We discovered that the onco-miR, miR-17 is a member of the epi-miRNAs.

6

Our findings, suggests an effect of stress on a signaling pathway involving mir17-5p upregulation and changes in gene expression of IL6ST and STAT3 (known to affect the astrocytic GFAP gene transcription).

Our findings, suggesting a link between mir17-5p upregulation and changes in gene expression of IL6ST and STAT3 (known to affect GFAP gene transcription, as summarized in Fig 9), provide new insight into the possible mechanisms mediating the effect of chronic stress on neuro-inflammation in the spinal cord.

Our samples were whole spinal cord segments, and while we showed mir17-5p expression co-localization with astrocytes in the dorsal horn of the spinal cord in stressed animals, we were unable to assess cellular specificity for our complete gene/miRNA expression data set.

However, although the exacerbation of the visceral sensitivity after treatment with the mir17-5p inhibitor was unexpected, it does not invalidate our hypothesis but illustrates the complexity of the system as miRNAs may affect the expression of multiple targets with opposing effects on nociceptive signaling which will be evaluated in further profiling studies.

When using the HNPP Fluorescent detection set for fluorescent detection of mir17-5p combined with immunofluorecent labeling for GFAP for astrocytes, staining for mir17-5p was verified in sections from stressed animals and while the expression was observed throughout the spinal cord, mir17-5p was also clearly expressed in the superficial laminae of the dorsal horn spinal cord where nociceptive fibers from the gut are distributed.

In addition, we observed changes in the expression of gp130 and STAT3 (involved in intracellular signaling cascades in response to gp130 activation), both predicted targets for miR-17-5p.

mir17-5p was of particular interest as its mRNA targets identified via the Ingenuity miRNA target filter, include IL6ST and STAT3.

Il6ST (gp130) was identified by the DIANA-microT target prediction tool as a gene target for mir17-5p.

MiR-148-3p, mir-17-5p, miR-181a-5p, miR-19b-3p and miR-24-3p were predicted to control the expression of the following target genes: Interleukin 6 signal transducer IL6ST (gp130).

Two groups of stressed rats were used to test the effect of the miRCURY LNA mir17-5p inhibitor probe (Exiqon, Cat #199900, CTGTAAGCACTTTG) or the scramble negative control probe (ACGTCTATACGCCA) on visceral sensitivity in stressed rats.

In addition, we used DNA Intelligent Analysis (DIANA) tools to further analyze targets for the mir17-5p.

Quantitative real time RT-PCR for Interleukin 6 signal transducer (gp130), the Signal Transducer And Activator Of Transcription 3 (STAT3), glial fibrillary acidic protein and mir-17-5p were performed to confirm levels of expression.

Sections stained with the NBT-BCP detection system showed high mir17-5p expression in the dorsal horn of the spinal cord from stressed rats (Fig 6).

We verified miR-17-5p increased expression in stress using qPCR and in situ hybridization.

Effect of the miRCURY LNA mir17-5p inhibitor on stress -induced visceral hyperalgesia.

Using an integrative high throughput approach, our findings suggest a link between miR-17-5p increased expression and gp130/STAT3 activation providing new insight into the possible mechanisms mediating the effect of chronic stress on neuroinflammation in the spinal cord.

Effect of the miRCURY LNA mir17-5p inhibitor or scramble control on stress -induced visceral hyperalgesia.

The expression of mir17-5p in the dorsal horn of the spinal cord where convergence of nociceptive signals from the gut occurs, supports our hypothesis that stress -induced alteration in the network connecting mir17-5p and the IL6ST/STAT3 system may be involved in the modulation of visceral sensitivity.

Mir17-5p is a potential regulator of the system by modulating the expression of IL6ST and STAT3.

Amongst the 5 miRNAs (miR148-3p, miR17-5p, miR181a-5p, miR19b-3p and miR24-3p) targeting multiple genes from our 70 genes list, mir17-5p, which is increased with stress was confirmed by qRT-PCR.

Testing the effect of the mir17-5p inhibitor on stress -induced visceral hyperalgesia.

In situ hybridization confirmed high expression of mir17-5p with stress in the dorsal horn of the spinal cord and the partial co-localization of mir17-5p with GFAP (labeling astrocytes) supports a potential modulatory role of mir17-5p on glial activity and neuro-immunomodulation.

We also found a significant increase in the expression of mir17-5p in stressed rats compared to controls.

Specifically, our analysis of miRNA-mRNA functional modules identified miR-17-5p as an important regulator in our mo del.

Target mRNA (IL6ST, IkBib and Hmbgb1, STAT3) and mir (mir17-5p) (Applied Biosystems) levels were quantified using a fluorogenic 5'-nuclease PCR assay using a 7500 Fast Real-Time PCR sequence detection system (Applied Biosystems, Foster City, CA).

This was confirmed by our results showing that treatment with a miRCURY LNA mir17-5p inhibitor during stress was able to modulate visceral hypersensitivity compared with a control scramble treatment.

0130938.g005 Fig 5 Mir17-5p was significantly up-regulated in samples from stressed rats compared to controls.

Mir17-5p was significantly up-regulated in samples from stressed rats compared to controls.

Interestingly, rats exposed to WA stress and receiving the treatment with the miRCURY LNA mir17-5p inhibitor probe exhibited exacerbated increase of the VMR to CRD compared with the scramble control (Fig 8).

B) In situ hybridization of mir17-5p (red) with co-immunostaining for GFAP (green) and DAPI (blue) in the dorsal horn of the spinal cord from stressed rats.

Increased mir-17-5p staining is observed in the dorsal horn.

The expression and localization of mir17-5p in the spinal cord was evaluated using in situ hybridization for mir17-5p.

For hybridization, 0.15nmol/ml of hsa-mir17-5p miRCURY LNA detection probe (88084-15) or positive control mir-124 miRCURY LNA detection probe and negative scramble control probe (90004) were incubated in hybridization buffer at 55 degree Celsius for one hour in an hybridization oven.

We measured the expression of the Interleukin 6 signal transducer gp130 (IL-6ST), I kappa b kinase epsilon (IKBKE), GFAP, high mobility group box 1 (Hmbg1), signal transducer and activator of transcription 3 (acute-phase response factor (STAT3) and mir17-5p, 148-3p and 19b-3p.

Representative images of mir-17-5p In situ hybridization in the dorsal horn of the spinal cord using the NBT-BCP detection system.

Arrows indicate evidence of mir-17-5p staining in peri-nuclear space colocalizing with astrocytes.

0130938.g007 Fig 7 A) In situ hybridization of mir17-5p (red) with co-immunostaining for GFAP (green) and DAPI (blue) in the dorsal horn of the spinal cord from control rats.

The co-immunostaining with GFAP revealed co-localization of mir17-5p with astrocytes, but also in the peri-nuclear region of other cells as shown by mir17-5p staining in DAPI positive cells (Fig 7A and 7B).

A modulatory role of spinal mir17-5p in the modulation of visceral sensitivity was confirmed in vivo.

In mir17-5p situ hybridization with co-immunofluorecent staining for GFAP.

A) In situ hybridization of mir17-5p (red) with co-immunostaining for GFAP (green) and DAPI (blue) in the dorsal horn of the spinal cord from control rats.

7

In parallel, p300 upregulation leads directly or indirectly to increased expression of miR-17∼92 cluster members that provides a brake on both processes and retards secondary maladaptive events.

The 3′UTR regions of several p300 -upregulated angiogenic genes, including HIF1a [26], [27] as well as p300 itself, contain the shared target site for miR-17-5p and 20a.

Interestingly, p300 overexpression in vivo was also associated with relative upregulation of several members of the anti-angiogenic miR-17∼92 cluster in vivo.

Relative expression of most members of the 17∼92 cluster was similar in all 4 cardiac chambers and in other organs, however, significant downregulation of miR-17-3p and miR-20a occurred between 1 and 8 months of age in both wt and tg mice.

This decline in miR-17∼92 cluster expression was accompanied by a steady rise in expression of VefgA at both mRNA (Figure 3B) and protein (Figure 3E) levels, suggesting that members of this cluster play a repressive role in myocardial vascular growth.

Relative expression of miR-17∼92 cluster members and an unrelated microRNA, miR-199, in Adp300- vs AdGFP -expressing cardiac myocytes.

Two members of the miR-17∼92 cluster, miR-17-3P and miR-20a, were upregulated in p300tg relative to WT myocardium in both young (1 month) and adult (9 month) mice (Figure 3A).

Co-regulatory Expression of p300 and miR-17∼92.

Confirming this finding, both miR-17-3p and miR-20a were upregulated in neonatal rat ventricular myocytes following adenoviral transduction of p300.

Importantly, this positive effect is counterbalanced by upregulation of members of the anti-angiogenic miR17∼92 cluster [14], [15].

A. Relative upregulation of miR-17-3p and miR-20a in p300 transgenic mice.

0079133.g004 Figure 4 A. Comparative expression of 7 members of the miR-17∼92 cluster in normal tissues.

In addition, miR-20a has been recently reported to reduce apoptosis following hypoxia-reoxygenation of cardiomyocytes [36], and overexpression of the miR-17∼92 cluster modestly improved cardiac function in a mouse mo del of myocardial infarction [37], suggesting that members of this cluster may have more general protective effects during oxidative or biomechanical stress.

Deletion of miR-17∼92 is embryonic lethal, due in part to defects in cardiac development [14], [44] which could arise from altered vasculogenic regulation.

A. Comparative expression of 7 members of the miR-17∼92 cluster in normal tissues.

Inverse Expression of miR-17∼92 and VegfA.

B. Comparative miR-17∼92 cluster expression in normal murine heart.

Impact of tissue type, p300 content and genomic context on miR-17∼92 cluster expression.

All members of the miR-17∼92 cluster were expressed in all tissues examined (Figure 4A) and in all 4 chambers of the heart (Figure 4B) consistent with previous reports [25].

Transduction of miR-20a, but not a control miR, repressed expression of a luciferase construct containing the p300 3′UTR miR17-5p/miR-20a binding site (Figure 5G, left); mutagenesis of this site eliminated miR-20a repression (Figure 5G, right).

Reciprocal regulation of myocardial VegfA and miR-17∼92 with age.

Although we were unable to confirm direct regulation by p300, MiR-17∼92 harbors conserved MEF2 and GATA binding sites within 500 bp downstream of the transcriptional start site that may reflect the presence of a p300-responsive enhancer (Figure 4E).

Members of the miR-17∼92 cluster can retard endothelial sprouting in Matrigel [41]; in addition, loss of miR-17∼92 is seen in several forms of cancer [15], [42], [43].

D. Gain of p300 induces multiple members of miR-17∼92 cluster.

E. Genomic structure of miR17∼92 cluster.

8

Of the 30 miRNAs they found upregulated in traumatic spinal cord injury, miR-223, miR-214, miR-20b-5p, miR-17, miR-146a, miR-199a-3p, miR-221-3p, miR-146b, and miR-145 were also upregulated in our study, and among the 16 downregulated miRNAs in traumatic spinal cord injury, miR-34a and miR-338 were also downregulated after ventral combined with dorsal root avulsion in our study.

While miR-142-5p and miR-219-5p were upregulated on the 3rd day after ventral combined with dorsal root avulsion, miR-17 and miR-199a-5p were upregulated on the 14th day after ventral combined with dorsal root avulsion and were predicted to target VGLUT1.

On the 14th day after injury, 25 miRNAs, including miR-31a-3p, miR-17-5p, miR-146b-5p, miR-154-3p, and miR-363-3p, were upregulated (Figure  2C), and 18 miRNAs were downregulated, including miR-433-3p and miR-496-3p (Figure  2D).

miR-142-5p and miRNA-219-5p, which were upregulated on the 3rd day; and miR-17 and miR-199a-5p, which were upregulated on the 14th day.

In the present study, by using the miRWalk database, we determined that the following altered miRNAs target the VGLUT1 gene: miR-142-5p, miR-219-5p, miR-17 and miR-199a-5p.

9

In contrast, the miRNA panel from lung specimens of MCT rats overexpressing hPGIS exhibited restoration of dysregulated miRNA levels to levels of naïve control rats, with downregulation of miRNAs that had been increased by MCT (miR-17, miR-21, and miR-223), and upregulation of miRNAs that had been decreased by MCT (miRs 424 and 503), Fig 5C].

MiR-17 was upregulated in the paraffin sections, but not in the fresh specimens, whereas miR-126, 145, 150 and 328 were not significantly downregulated in the paraffin sections as compared to the fresh specimens.

This increase was accompanied by significant increases in miR-17, 21 and 223 expression levels in plasma relative to vehicle controls (Fig 1D), whereas miR-145 was downregulated in plasma (Fig 1D).

Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs.

For example, inhibition of miR-17 attenuated PAH in both the MCT and chronic hypoxia PAH mo dels.

Alterations in miR-17, 21, and 145 expression levels have been associated with disrupted BMPR2 signaling [12, 15, 40].

We also detected several other dysregulated miRNAs in plasma, including miR-17, 21, 126, 145, and 223 (see Table 1), which have potential implications for use as biomarkers in PAH.

MiR-17, miR-21, and miR-145 dysregulation have been linked to TGFβ, BMPR2 and RhoA/RhoB kinase signaling [24– 26].

The miR-17–92 cluster also regulates several proteins involved in cell cycle progression, such as E2F1 and p21 [10].

Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated.

10

[23] A previous study also suggested that attenuation of miR-1/miR-133 transcription leads to the up-regulation of their direct downstream target cyclin D1,[24] and the abundance of cyclin D1 and expression of miR-17 were inversely correlated.

Only miR-17 directly suppresses cyclin D1 expression (Fig 3).

All miRNAs except miR-17 repress Akt activation, and miR-1 and miR-133 indirectly suppress cyclin D1 expression.

miR-1, miR-17, and miR-133 suppress cyclin D expression.

A previous study has shown that, of the various miRNAs, the down-regulation of miR-1, miR-133, and miR-17 causes activation of Akt and cyclin D1.

Collectively, we conclude that APC and IPC are related to miR-1, miR-17, miR-133, and miR-205, which suppress the Akt–GSK–cyclin D1 pathway.

Four miRNAs (miR-1, miR-17, miR-133, and miR-205) related to the Akt–GSK–cyclin D1 pathway were significantly down regulated by both APC and IPC treatment (p < 0.05, Table 2).

APC, anaesthetic preconditioning; IPC, ischaemic preconditioning All the miRs, except miR-17, repress Akt activation.

0125866.g003 Fig 3 All the miRs, except miR-17, repress Akt activation.

11

Specifically, mir-301 and mir-17-5p showed different expression levels after occlusion, while mir-301 expression decreased, we observed an increased in mir-17-5p expression compared to control.

The delivery of exogenous miR-17 suppressed the apoptotic protease activating factor 1 (Apaf-1) expression and consequently attenuated formation of the apoptosome complex containing caspase-9, as demonstrated by co-immunoprecipitation and immunocytochemistry.

miR-17 targets tissue inhibitor of metalloproteinase 1 and 2 to modulate cardiac matrix remo deling.

Thus, it suggests that miR-17 participates in the regulation of cardiac matrix remo deling and provides a novel therapeutic approach using miR-17 inhibitors to prevent remo deling and heart failure after MI (Li et al., 2013).

We detected an increased expression of miR-17-5p only after occlusion procedure.

Using real-time PCR, miR-17 was up-regulated most dramatically: 3.7-fold and 2.4-fold in the infarct region 3 and 7 d post-MI, respectively, and 2.4-fold in the border zone at d 3 compared to sham control (P < 0.01).

MiR-17 was identified as a novel Apaf-1 -targeting miRNA (Song et al., 2015).

Furthermore, miR-17 suppressed the cleavage of procaspase-9 and the subsequent activation of caspase-3, which is downstream of activated caspase-9. Together, these results demonstrated the potential of miR-17 as an effective anti-apoptotic agent (Song et al., 2015).

MicroRNA-17 -mediated down-regulation of apoptotic protease activating factor 1 attenuates apoptosome formation and subsequent apoptosis of cardiomyocytes.

12

The mir-17 family is the one most enriched (p = 3.24 E-4; Table S6) and comprises mir-17, mir-18a, mir-19a, mir-20a, mir-19b-1 and mir-92-1. This family is expressed as polycistronic units, revealing a common regulatory mechanism [62], that is confirmed by the similarity of their expression profiles (Figure 4 D).

The study of these miRNAs could be a good basis for the identification and analysis of potential immuno-modulatory effectors in immuno -mediated diseases like multiple sclerosis, where a down-regulation of miR-17 and miR-20a associated with T-cell activation was demonstrated [80], or like inflammatory myopathies.

The over -expression of mir-17, 18, 19a, and 20 was demonstrated in tumors of the lung [79] and a second study reported the up-regulation of the miR-17-92 cluster in B-cell lymphomas [62].

We found that miRNAs with higher expression in WBCs includes different miRNA families: mir-15, mir-17, mir-181, mir-23, mir-27 and mir-29 families.

The mir-17 family showed the most pronounced expression in WBC (Figure 4D and Table S6).

We found, on the contrary, that mir-17, 18, and 20a are not expressed in normal lung (Figure 4 D).

* indicates components of mir-17 family.

13

miR-17 and miR-20a inhibitors and mimics were used as positive controls, since these two miRNAs were previously shown to target HIF-1α.

In silico prediction of miRNA: Hif-1α interaction miRNAs miRNAs conserved in rodent and human (predicted by at least 2 databases) miR-17 [[] [16] []], -18a [[] [16] []], -20a [[] [16] []], -20b-5p [[] [22] []], -135a, -135b, -138, -199a-5p, -203, -335, -338-3p, -93 MiRNA: Hif-1α target prediction was performed and 12 miRNAs, commonly predicted in at least 2 out of the 6 databases used, were selected.

Ten of them, miR-17, -18a, -20a, -20b-5p, -135a/b, -203, -335, -338-3p and -93 were found to be differentially and significantly (p<0.05) expressed in our miRNA profiling analysis of eMCAo rat brain samples (Fig 1D).

Among these miRNAs, miR-17 and miR-20a have been reported to directly regulate HIF-1α in lung cancer cells [16].

Among the 10 miRNAs, interaction of miR-17, -18a, -20a and -20b-5p with HIF-1a had been reported previously in cancer pathogenesis [16, 22] whereas the remaining six miRNAs, miR-135a/b, -203, -335, -338-3p and -93 had not been validated in any disease condition.

Independent transfection of HeLa cells with anti miR-17/-20a/-335/-93 exhibited an increase in the relative luciferase activity, whereas introduction of miR-17/-20a/-335/-93 mimics resulted in a reduction in luciferase activity suggesting that, apart from miR-17 and miR-20a, miR-335 and miR-93 are also direct regulators of Hif-1α (Fig 2B).

The search yielded 12 miRNAs (miR-17, -18a, -20a, 20b-5p, -93, -135a/b, -138, -199a-5p, -203, -335, -338-3p) as potential regulators (Table 1).

miR-17 and -20a were also included in the validation study as positive controls for they were previously reported to be the strongest regulators of HIF-1α in cancer pathogenesis [16].

The predicted binding site(s) of selected miRNAs (miRNA-17, -20a, -135a, -203, -335, -338-3p and -93) to the 3'UTR of Hif-1α is mapped in this figure.

Based on the in silico prediction, we identified miR-17, -20a, -135a, -203, -335, -338-3p and -93 to be predicted by at least two databases and to be conserved in both rodents and human.

miR-93 was observed to share the same binding site as miR-17 and miR-20a while miR-335 had two binding sites.

14

While there was no significant effect of quercetin on miR-485-3p expression in Caco-2 cells, we identified miR-17-3p as a quercetin -induced candidate regulator of FPN mRNA expression.

miR-17-3p was strongly up-regulated in quercetin -treated Caco-2 cells (Figure 6B).

Expression of miR-17-3p was elevated significantly following exposure to quercetin, and bioinformatics identified a consensus binding site for miR-17-3p (bases 61-67 of the 3′UTR sequence) in the human FPN 3′UTR.

Finally, we used qPCR to validate the array data to determine whether expression of the miR-17 species was altered following quercetin treatment.

The miR17 cluster is one of the most wi dely studied in microRNA biology and has been shown to play an important role in a number of biological processes in both health and disease [49].

In contrast, there was no significant effect of quercetin on the expression of miR-17-5p (Figure 6C).

Our data suggest a role for miR-17 and potentially other microRNAs in mediating diet-gene interactions that can influence nutrient bioavailability.

Both miR17-3p (24 [th]) and miR17-5p (12 [th]) are among the top 30 miRNAs predicted to interact with the FPN 3′UTR.

Binding sites for 2 members of the miR-17 family, miR-17-3p (bases 61-67 of the 3′UTR sequence) and miR-17-5p (2 sites at bases 1132-1138 and 1166-1172), respectively, were present in the FPN 3′UTR (Figure S2).

Figure S2 Predicted binding sites for miR17-3p, miR17-5p and miR485-3p in human FPN 3′UTR.

15

After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127.

miR-17-5p was demonstrated to inhibit translation of SRC-3/AIB1/NCOA3 [194].

Overexpression of miR-17-5p reduced E [2]-stimulated proliferation of MCF-7 breast cancer cells, indicating a role for deregulation of miR-17-5p in breast cancer [194].

Transfection of CHO-K1 cells with ERα and miR-17-5p inhibited E [2]-stimulated ERE -driven luciferase reporter activity by 50%.

This report also demonstrated that transfection of MCF-7 cells (which do not express miR-17-5p) with miR-17-5p reduced E [2] -induced proliferation and E [2] -induced endogenous cyclin D1 transcription [194].

The breast cancer oncogene/coactivator AIB1/SRC-3/NCOA3 is regulated by mir-17-5p and there is a reciprocal relationship between reduced miR-17-5p and increased AIB1 in breast cancer cells [194].

16

Specifically, miR-195 potentially regulates vesicle -associated membrane protein 1 (VAMP1), miR-30a targets actinin, alpha 1 (ACTN1), miR-21 targets paired-like homeodomain 2 (PITX2) in D6; miR-132 potentially regulates solute carrier family 2, member 1 (SLC2A1), nuclear receptor subfamily 4, group A, member 2 (NR4A2) and Cdc42 guanine nucleotide exchange factor 9 (ARHGEF9), miR-203 targets calcium binding protein 7 (CABP7), miR-17-5p targets early growth response 2 (EGR2) in S6; miR-330 potentially regulates CD247, nerve growth factor receptor (NGFR) and FAT tumor suppressor homolog 3 (FAT3), miR-338 targets ADAM metallopeptidase domain 17 (ADAM17), miR-218 targets src kinase associated phosphoprotein 1 (SKAP1), miR-185 targets calcium channel, voltage -dependent, N type, alpha 1B subunit (CACNA1B) in S9.

17

Both up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182) and down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) were chosen as a parameter for comparison.

Using these hepatocyte and non-hepatocyte cell lines and primary tissues, we performed unsupervised clustering analysis by selecting 7 down-regulated miRNAs (miR-17-5p, miR-18a, miR-93, miR-106a, miR-106b, miR-130b and miR-375) and 4 up-regulated miRNAs (miR-21, miR-22, miR-122a and miR-182).

While the reduction in expression of miR-17-5p, miR-18a, miR-20a, and miR-92 were well coordinated in transdifferentiation, the expression of miR-19a was not concordant with its neighboring microRNA genes.

The genes encoding for miR-17-1/miR-17-5p, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1 are clustered on chromosome 15 [35].

18

Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice.

As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice.

In addition, the miR-17-19 cluster, which comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a, miR-20, miR-19b, and miR-92-1) and promotes cell proliferation in various cancers, has been demonstrated to be significantly upregulated at the clonal expansion stage of adipocyte differentiation.

Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b.

19

Meanwhile, the expression of miR-17 and miR-708 were analyzed before and after differentiation indicating the downregulation of miR-17 and upregulation of miR-708 upon differentiation of c-kit(+) cells (Figure 2F), suggesting that miR-708 may positively regulate differentiation of cardiac stem/progenitor cells.

As positive controls, differentiation miRNA let-7 showed lower expression while miR-17 showed higher expression in c-kit(+) progenitors (Figure 1E).

20

Furthermore, we and Gorter et al. 24 observed the up-regulation of miR-17-5p, miR-20a-5p, miR-23a-3p and the down-regulation of miR-139-5p, whereas we and Bot et al. 23 observed the down-regulation of miR-551b-3p.

First, a subgroup of miRNAs (miR-15b-5p, miR-17-5p, miR-18a-5p, miR-19a-3p, miR19b-3p, miR-20a-5p, miR-20b-5p, miR-21-5p, miR-23b-5p, miR-24-3p, miR-27a-3p, miR-92a-3p, miR-93-5p, miR-142-3p, miR-344b-2-3p, miR-431, miR-466b-5p and miR-674-3p) displayed increased expression levels during latency (4 and 8 days after SE), decreased their expression levels at the time of the first spontaneous seizure and returned to control levels in the chronic phase (Fig. 2, Supplementary Fig. S1).

21

For instance, miR-17~92 facilitated LR in an oestrogen -dependent manner [16], an increased expression of miR-34a led to inhibited hepatocyte proliferation during the late phase of LR [17], and miR-21 was upregulated in the early stage of LR, which targeted Pellino-1 to regulate NF-kappaB signaling [18].

22

From the top twenty miRNAs showing highest expression in A2B5+ GalC− cells, miR-130a, miR-16, miR-17, and miR-20a were also in the top twenty expressed miRNAs from our GPs.

Additionally, miR-17 and miR-20a were predicted to target membrane associated guanylate kinase, WW and PDZ domain containing 3 (MagI-3), a junctional protein found in astrocytes [40].

Similarly, miR-17, miR-20a, miR-21, miR-16, miR-103, and miR-107 identified in A2B5-GalC+ cells showed overlapping expression with our OPs.

23

Since co-expressed miRNAs have been shown to coordinately regulate canonical cell signaling networks associated with cell death and cell survival [18], it is notable that we found that all members of the miR-17-92 cluster (miR-17-5p, miR-18a, miR-19a, miR-92a) are upregulated after TBI and these miRNAs co-target and possibly negatively co-regulate many TBI-altered genes.

Bdnf has a large, 2.9 kb 3′UTR with multiple seed binding sites for several miRNAs differentially affected by TBI, miR-15b, miR-146b, miR-17-5p (all increased) and miR-181c (decreased).

24

In this sense, by virtue of miRNAs known mechanism of action, reducing gene expression by binding to the 3'UTR of their targeted genes, a number of evidenced miRNA species (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) might be involved in turning off the 'neuron projection morphogenesis' process in the SHVT group.

Other deregulated biological processes included ‘blood vessel development’ (Mir-155, Mir-17-5p and Mir-130a) (FDR = 6x10 [-4]), 'lung development' (Mir-17-5p and Mir-27a) (FDR = 4x10 [-4]), and ‘cell motion’ (Mir-103) (FDR = 8x10 [-4]) (S3 Table).

A heatmap built from nominally significant miRNAs between SHVT and NA detected by sRNA-seq are shown in S3 Fig. When comparing the direct sequencing of the samples with the bioinformatic prediction, 28 miRNA species overlapped, from which Mir-27a, Mir-103, Mir-17-5p, Mir-130a, and Mir-155 were nominally significant although the abundance of the latter was observed to be opposite to the one deduced by GSEA (Table 2).

Interestingly, this process was the only one involving all four miRNA species with a consistent abundance among microarray -based predictions and sRNA-seq experiments (Mir-27a, Mir-103, Mir-17-5p and Mir-130a) (FDR<1x10 [-4]) (S3 Table).

25

Nakanishi et al. [5] observed similar changes in miR-223 and miR-124 expression, which were also observed by Liu et al. [6], and these studies also identified coincident expression changes in miR-21, miR-146a, and miR-17, among others.

Expression changes respect to control/sham 1 dpo 7 dpo Name Liu Present Liu Present rno-miR-130b 1.42 NE rno-miR-146a 1.72 INC S rno-miR-15b 1.15 DEC NS rno-miR-17 1.74 INC NS rno-miR-18a 2.71 NE 3.41 NE rno-miR-200c 4.12 NE rno-miR-206 3.26 NE rno-miR-20a 1.69 NC rno-miR-20b-5p 1.83 NE rno-miR-21 1.37 INC S rno-miR-214 2.01 INC NS rno-miR-219-5p −1.82 DEC S rno-miR-221 1.1 NE rno-miR-223 3.58 INC S 3.4 INC S rno-miR-24-2* 2.41 DEC NS rno-miR-290 3.66 INC NS 2.96 DEC S rno-miR-378 1.31 INC NS rno-miR-410 −1.21 NE rno-miR-466b 3.05 DEC S rno-miR-541 1.11 INC S rno-miR-874 2,8 NEData restricted to microRNAs with significant changes in expression (2-fold or greater) according to Liu et al. [6].

26

Similarly, the specific miRNA profile of AFL consisted of five downregulated (miR-93, miR-451, miR-221, miR-17-5p and miR-146a) and three upregulated (miR-200c, miR-490 and miR-195) miRNAs, in comparison to the control group.

Wiskott-Aldrich syndrome protein family member 1 (Wasf1), which was found to be regulated by miR-17-5p, miR-93, miR-191, miR-451, miR-146a and miR-140, has been shown to be a protective alcohol-responsive gene in the prefrontal cortex of human alcoholics (38).

27

It was reported that RV could restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer [11], and also could inhibit STAT3 activation, enhancing autophagy and apoptosis in rat orthotopic glioblastoma [12].

28

D. Effect of miR-204, miR-93, miR-17, miR-302d, miR-455, miR-212 or miR-30a overexpression on Nurr1 3’ UTR long.

Seven miRNAs were selected: miR-17, miR-204, miR-455, miR-30a, miR-212, miR-302d and miR-93.

The seed sites of miRNAs selected for the specific part of the long 3’UTR are: miR-204 in nucleotide 870, miR-212 in nucleotide 1014, miR-93 and miR-302d in nucleotide 1063, miR-17 in nucleotide 1070, miR-455 in nucleotide 1177 and miR-30a in nucleotide 1279.

The precursor sequences of the miR-145, miR-302d, miR-130a, miR-204, miR-93, miR-17, miR-455, miR-212 and miR-30a were cloned on pEGP-CE vector, acquired from Cell Biolabs Inc (7758 Arjons Drive San Diego, CA 92126 USA).

The intersection of these 3 databases gave 14 miRNAs in common and we choose miR-204, miR-30a, miR-302d, miR-212, miR-93, miR-17 and miR-455 for further experimentation.

29

MiR-19 of the miR-17–92 cluster promotes NSC proliferation [15] and targets FoxO1 to regulate NSC differentiation through cooperation with the Notch signaling pathway [16].

MiR-17/106 targets p38 to modulate neural stem/progenitor cell multipotency [14].

MiR-19a is located in the miR-17–92 cluster, which promotes the NSC proliferation via repression of PTEN [15].

30

Additionally, Yuan et al. determined that thousands of miRNAs, such as miR-21, miR-17, and miR-92a, are up-regulated, whereas others, such as miR-205 and miR-145, are downregulated in the setting of femoral head repair using high-throughput gene chip technology [22].

31

HIF-1alpha downregulates miR-17/20a directly targeting p21 and STAT3: a role in myeloid leukemic cell differentiation.

32

Jin Y. Jin Y. Chen B. Tipple T. E. Nelin L. D. Arginase II is a target of miR-17-5p and regulates miR-17-5p expression in human pulmonary artery smooth muscle cellsAm.

33

Significant mechanical allodynia was observed in rats overexpressing miR-18a, miR-19a, miR-19b or miR-92a, but not in those overexpressing miR-17 or miR-20a (Fig. 2e).

Clone IDs of TuD were as follows: NC000001 (negative control), RH000611 (miR-17), RH000323 (miR-18a), RH000643 (miR-19a), RH000352 (miR-19b), RH000277 (miR-20a) and RH000184 (miR-92a).

34

We observed that changes in the expression of nine miRNAs (miR-24, miR-25, miR-7a, miR-103, miR-17-5p, miR-106b, miR-93, miR-206 and miR-133b) analyzed by qRT-PCR were consistent with those by miRNA microarray at p < 0.05 (Figure 3).

We found that expression of many miRNAs (miR-24, miR-25, miR-7a, miR-103, miR-17-5p, miR-106b, miR-93, miR-206 and miR-133b) changed significantly during conditions of UPR in cardiomyoblasts.

35

Differential expression of miR-23a, miR-23b,miR-542–3p, miR-211, and miR-17–5p in granulosa/cumulus cells from women undergoing assisted reproduction suggests aberrant miRNA expression may be an underlying etiology in female infertility [16, 17].

36

For example, miR-17 [12] and miR-100 [13] were up regulated while miR-10a [14] and miR-205 [15] were downregulated during the osteogenic differentiation in bone mesenchymal stem cells of rats (rBMSCs).

37

Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451.

Hypothalamus miR-17, miR-29c, miR-124a-1, miR-128a, miR-150, miR-199a, miR-217, miR-223, miR-329, miR-429.

Dorsal root ganglion let-7c, miR-17, miR-145, miR-150, miR-199a, miR-223, miR-365, miR-451.

Brain stem let-7c-1, miR-17, miR-135b, miR-150, miR-199a, miR-218-1, miR-223, miR-329.

38

For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig).

39

Previous studies have found that dicer1 and miR-17 expression were increased in reactive astrocyte, and it is also reported that dicer1 plays an important role in astrocyte development [7].

40

However miR-151*, miR-10a-5p, miR-205, miR-17-5p, miR-145 and miR-664 were up-regulated in the AcarH group (fold change>2, P<0.05, Table 2, Figure 4).

41

Robbins ME, Dakhlallah D, Marsh CB, Rogers LK, Tipple TE: Of mice and men: correlations between microRNA-17 approximately 92 cluster expression and promoter methylation in severe bronchopulmonary dysplasia.

Rogers LK, Robbins M, Dakhlallah D, Yang Z, Lee LJ, Mikhail M, Nuovo G, Pryhuber GS, McGwin G, Marsh CB, Tipple TE: Attenuation of miR-17 approximately 92 Cluster in Bronchopulmonary Dysplasia.

42

Complementary to our results, Lerner and colleagues reported that hyperactivated inositol-requiring enzyme1α (IRE1α), a protein in the ER transmembrane like PERK, can also induce TXNIP expression at the posttranscriptional level through selective decay of TXNIP-destabilizing microRNA-17 [29].

43

Hajarnis S, Lakhia R, Yheskel M, Williams D, Sorourian M, Liu X, Aboudehen K, Zhang S, Kersjes K, Galasso R, Li J, Kaimal V, Lockton S, Davis S, Flaten A, Johnson JA, Holland WL, Kusminski CM, Scherer PE, Harris PC, Tru del M, Wallace DP, Igarashi P, Lee EC, Androsavich JR, Patel V 2017 microRNA-17 family promotes polycystic kidney disease progression through modulation of mitochondrial metabolism.

44

Li et al. pointed out that cir-ITCH interacted with 3 molecules of miR-7, miR-17 and miR-214 to increase the level of ITCH and suppress the ESCC [20].

45

Overexpression of miR-17-5p promoted HSCs proliferation and activation by activating the Wnt/ β-catenin pathway [11].

46

miR-17, miR-92a and miR-127 have been shown to regulate lung development [11, 12].

47

For example, studies by both Harada et al. and Molitoris et al. report the glucocorticoid -mediated repression of the miR-17 family, resulting in increased Bim expression, and, consequently, increased sensitivity to glucocorticoid -induced apoptosis [31, 32].

48

In addition, hyperactivated IRE1α improves TXNIP mRNA stability through selective degradation of TXNIP-destabilizing microRNA-17 by its endoribonuclease activity.

When ER stress reaches a certain threshold, IRE1α selectively degrades four pre-microRNAs, including four microRNAs (miR-17, miR-34a, miR-96 and miR-125b) [49].

Among these, miR-17 has been confirmed to function as a TXNIP mRNA-destabilizing microRNA [15].

49

For instance the mature miRNA sequence of MP-56 has only two mismatches with mmu-mir-17, mmu-mir-20 and mmu-mir-106a.

A nice example is the cluster of hsa-mir-17, whose elements reside within a 1 kb interval on human chromosome 13 and are indeed co-transcribed (cDNA Genbank accession number BC040320).

In the mir-17 cluster paralog on chromosome X, whose evolution has been analyzed in detail by Tanzer and Stadler [22], we found two additional miRNAs that are conserved in all three species.

50

[39] Also, newly investigated microRNA could have a potential role in this signaling pathway, as Dr Hart's team demonstrated the implications of miR17‐92 and miR21 in PPARγ regulation, [40] and we also demonstrated that miR‐204 could indirectly, through Src kinase activity, modulate BMPR2 expression.

51

In our previous study [12], we found that miR-17, miR-19a, miR-20a, miR-19b and miR-92a, but not miR-18a, were highly expressed in the heart of C57BL/6 mice.

52

Among the spleen-specific miRNAs identified, five of them belong to the mir17 miRNA cluster, which comprise miR-17, miR-18, miR-19a, miR-19b, miR-20, miR-25, miR-92, miR-93, miR-106a, and miR-106b [59].

The mir-17–92 polycistron is located at 13q31, a genomic locus that is often amplified in cancers.

53

Several miRNAs, including miRNA-17, -139, and -301a, were capable of down -regulating the ASK1 protein level.

54

The probes used were: EAM119 (miR-29b), EAM125 (miR-138), EAM224 (miR-17-5p), EAM234 (miR-199a), EAM131 (miR-92), EAM109 (miR-7), EAM150 (miR-9) and EAM103 (miR-124a).

The mir-17 cluster on chromosome 14 fulfills all these criteria.

55

Indeed, when the data of the Yamaura’s study were compared with findings of the present study several miRNAs were regulated in common and included for blunt steatosis miR-10b and miR-183; similarly with NASH the miRNAs miR-17, miR148b-5p and miR-197 were commonly regulated thus providing independent evidence for their diagnostic utility in animal studies.

56

The miRNAs differentially regulated by prenatal stress includes miR-23a (up), miR-129-2 (up), miR-361 (down), let-7f (up), miR-17-5p (down), miR-98 (up), miR-425 (down), miR-345-5p (down), miR-9 (up), miR216-5p (up), miR-667 (up), and miR-505 (down) (Figure 3A).

57

For example, Pparα (regulates metabolic pathways) was found to harbor putative binding sites for miR-19b/351 (5 algorithms), miR-17-5p (3 algorithms), miR-214 and -503 (2 algorithms).

58

Luan Y. Chen M. Zhou L. MiR-17 targets PTEN and facilitates glial scar formation after spinal cord injuries via the PI3K/AKT/mTOR pathwayBrain Res.

59

Our cardiac-specific GSA recapitulated the previously known miRNA-pathways, including miR-486 in PI3K-Akt signaling (p-value: 1.59E-03) [24], miR-17–92 in TGF-β signaling (p-value: 6.34E-03) [54] and miR-378 in MAPK signaling (p-value: 1.76E-02; S2 Table) [9].

60

We began by measuring the levels of several miRNAs reportedly associated with cardiovascular diseases, including mir-129, mir-106, mir-26a, mir-20, mir-197, mir-17, mir-27 and mir-30d, 24, 25, 26, 27, 28, 29 in cardiomyocytes under both normal and high-glucose conditions.

61

Among these miRNAs, miRNAlet-7a, miRNA-124, and miRNA-137 were reported to induce neuroprotection after cerebral ischemia, while miRNA-34a, microRNA-181c, and miRNA-17–92 were reported to exacerbates brain injury in ischemic Stroke (Szulwach et al., 2010; Liu et al., 2013; Hamzei Taj et al., 2016; Liang and Lou, 2016; Ma et al., 2016; Wang et al., 2016).

62

B, RT-PCR of mature miR-328, miR-378, miR-17-3p, and miR-17-5p using RNA prepared from A431 cells stably transfected with miR-328 and a control vector, confirming that processing of other microRNAs was not affected by miR-328 transfection.

63

On the other hand, other miRNAs such as, let-7i, miR-143, miR-148b-3p, miR-15b, miR-17-5p, miR-24, miR-27b, miR-92a, miR-106b, miR-125b-5p, miR-181a, miR-181c, miR-181d, miR-200c, miR-375, miR-107, miR-141, and miR-370, were present at higher levels in colostrum whey than in mature milk whey (Fig. 6).

64

In addition, exosomes released from stem cells and some micro RNA, such as miR17–92 cluster and miR-124a are also able to enhance neurogenesis post ischemic stroke 19– 21.

65

On the other hand, both EEP and Pn significantly inhibited in a dose -dependent manner the activation of HIF1 α. Finally, VEGF mRNA and microRNAs associated with angiogenesis in previous studies (miR-126, miR-19b, miR-221, miR-222, miR-27b, and miR-17) were evaluated by real-time PCR.

66

Both miR-17 and miR-19, as representatives of the miR-17-92 cluster, were tested in all tissues, but no changes were observed between controls and aGvHD rats (data not shown).

67

These miRNA are miR-17 miRNA precursor family; these are a group of related small noncoding RNA.

68

MiR-20a, a member of the miR-17–92 cluster, is a highly conserved miRNA within a noncoding RNA encoded by the c13 or f25 host gene localized on chromosome 13 [31].

69

Comparison of the qPCR and Nanostrings data revealed agreement for miR-1, miR-126, and miR-17, which were unchanged after SCI by both methods (Fig 2, Tables 1 and S1).

70

The miR-17-92 cluster (polycistronic miRNA gene) encodes six miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) located in the third intron of a ~7-kb primary transcript known as C13orf25 [61].

71

9 -45.6 mmu-miR-27b -1.8 -71.4 -462.7 mmu-miR-214* -2.6 -5.0 -43.5 mmu-let-7c-1* -73.2 -204.4 -334.1 mmu-miR-34c -9.4 -26.1 -42.7 mmu-miR-542–3p -5.9 -195.6 -319.8 mmu-miR-706 -9.3 -5.0 -38.7 mmu-miR-487b -2.0 -161.5 -263.9 mmu-miR-467b* -10.1 -2.2 -33.6 rno-miR-17–3p -1.6 -152.0 -248.5 mmu-miR-323–3p -3.7 -23.3 -29.8 mmu-miR-10b -2. 4 -136.6 -223.3 mmu-miR-202–3p -6.5 -5.9 -21.4 mmu-miR-29b -3.0 -135.1 -220.9 mmu-miR-339–5p -1.6 -9.6 -19.6 mmu-miR-297a* -2.4 -128.4 -209.8 mmu-miR-181c -2.0 -10.5 -14.6 mmu-miR-692 -41.5 -115.8 -189.2 mmu-miR-203 -4.6 -6.4 -13.8 mmu-miR-208 -40.6 -113.5 -185.5 mmu-miR-467a* -2.6 -3.9 -11.4 mmu-miR-467c -38.9 -108.6 -177.

72

hsa-mir-17 belonged to a polycistronic cluster (also containing hsa-mir-18a, hsa-mir-19a, and hsa-mir-20a) residing in a large genomic region highly enriched with TF binding sites, let-7a and let-7f, also likely to be transcriptionally coupled, were also enriched with TFBSs, and mir-7-1 was also found in a large genomic region with high density of TFBSs.