sort by

36 publications mentioning hsa-mir-940

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-940. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 298
Other miRNAs from this paper: hsa-mir-221, hsa-mir-324
Together, these results demonstrate that miR-940 is differentially expressed between normal and cancer cells and that it targets and regulates MIEN1 expression. [score:8]
Together, this indicates that the endogenous miR-940 was causing translational repression of the MIEN1 mRNA rather than degradation in PC-3. Thus, these results show that while miR-940 causes MIEN1 mRNA degradation in DU-145 (ectopic and conceivably endogenous expression) and PWR-1E (endogenous), it causes translational repression of MIEN1 in PC-3 cells (endogenous). [score:7]
The ectopic expression of miR-940 decreased the invasiveness of DU-145 -5-fold (Figure  6C), which was abridged by reintroduction of non-targetable MIEN1 ORF construct and conversely, the invasiveness of PC-3 was ~3.5-fold higher upon inhibition of endogenous miR-940 by anti-miR-940 (Figure  6D). [score:7]
Apart from the potential use of miR-940 in tissues and serum as a biomarker along with the expression of MIEN1, studying the regulation of miR-940 itself may provide more insight into the mechanism of its expression pattern and the reasons for its loss in cancer, which from our results, indicates facilitation of cancer progression. [score:6]
In this study, we have identified a novel miRNA, hsa-miR-940 (miR-940), which targets and regulates MIEN1 expression. [score:6]
Since, MIEN1 is one of the direct targets of miR-940, we sought to determine if the ectopic overexpression of miR-940 could attenuate these processes, independent of the effect that miR-940 may have on other transcripts. [score:6]
Our study indicates that miR-940 expression inversely correlates with tumor progression in clinical prostate cancer and the loss of miR-940 in cancer causes an increased expression of MIEN1 which in turn enables prostate cancer progression. [score:5]
Associating the expression patterns of miR-940 and MIEN1 with the early detection and differentiation of the indolent from aggressive disease will be a valuable tool that could be used clinically for early prostate cancer detection. [score:5]
Our study demonstrates that miR-940 completely inhibits this ability of prostate cancer cells along with promoting MET by increasing the E-cadherin and decreasing Vimentin expression. [score:5]
Though the overall proliferation was unaltered, the ectopic expression of miR-940 reduced the anchorage-independent growth of cells, increased E-cadherin and decreased slug expression, suggesting facilitation of mesenchymal-to-epithelial transition (MET). [score:5]
In addition to this expression pattern, our data prove that inhibition of miR-940 has different effects on MIEN1 mRNA and protein levels in the various cell lines. [score:5]
Figure 5 miR-940 targets MIEN1 and affects MMP-9, uPA and VEGF expression in a cellular context -dependent manner. [score:5]
However, in PC-3, where MIEN1 mRNA is expressed but protein is low, inhibition of miR-940 with anti-miR-940 resulted in no further increase of MIEN1 mRNA but only increased MIEN1 protein. [score:5]
Hence, we are the first to report that miR-940 inhibits prostate cancer migration and invasion, at least in part via MIEN1 along with other probable targets. [score:5]
Conversely, the loss of the endogenous miR-940 in DU-145 possibly led to the overexpression of both MIEN1 mRNA and protein; and hence ectopic overexpression of the miR-940, as we have observed, caused MIEN1 mRNA degradation resulting in significant depletion of both transcript and protein levels. [score:5]
Subsequently, using BLAST and in silico algorithm -based predictions, we identified three microRNAs, hsa-miR-324-3p, hsa-miR-221, and hsa-miR-940, that were differentially expressed between DU-145 and PWR-1E cells and could potentially target MIEN1 3′UTR (Additional file 2: Figure S2A and S2B) [20, 21]. [score:5]
In the small pilot cohort of 15 samples, we observed that the miR-940 expression was higher in the matched normal sections in contrast to the low expression in the tumor cells (represented in Figure  3C). [score:5]
The miR-940 inhibited migratory and invasive potential of cells, attenuated their anchorage-independent growth ability, and increased E-cadherin expression, implicating its role in mesenchymal-to-epithelial transition (MET). [score:5]
In two specific patients who had undergone surgical resection via radical prostatectomy, we observed that miR-940 expression was high in normal glands and benign prostatic hyperplasia with the expression being lower in infiltrating prostate cancer cells (Figure  3A and B). [score:5]
Since we observed that the ectopic overexpression of miR-940 did not have a higher reduction in luminescence compared to the miR-NT co-transfections, it is possible that the regulation of MIEN1 in PC-3 cells may not necessarily involve mRNA degradation; it may just be translational repression. [score:5]
But, when we inhibited miR-221 alone in PC-3, we did not see any increase in MIEN1 (Figure  2B, left), implying miR-940 to be a more potent regulator of MIEN1 than miR-221. [score:4]
The preliminary examination of the results obtained from DAVID was then represented as a function of the number of genes involved within the pathway that could be downregulated by miR-940 (Additional file 6: Table S1A), and further classified based on the significance of the overall pathway alteration (Additional file 6: Table S1B). [score:4]
A significantly higher expression of miR-940 was observed in the non-malignant cells, PWR-1E (~3-fold) and HPV-18C-1 (~7.5-fold), compared to DU-145 and LNCaP, while, PC-3 showed ~1.5-fold higher expression of miR-940 (Figure  1A). [score:4]
To further confirm the possibility of the involvement of miR-940 in hindering EMT, we performed immunostaining for E-cadherin, a cell adhesion marker that is downregulated if the cells undergo the process of EMT, and Vimentin, a mesenchymal marker. [score:4]
Analysis of human prostate tumors and their matched normal tissues confirmed that miR-940 is highly expressed in the normal tissues compared to its low to negligible expression in the tumors. [score:4]
Hence, miR-940, indirectly through MIEN1, is capable of decreasing expression levels of specific proteins that facilitate migration and invasion. [score:4]
We have seen that miR-940 expression is high in the normal and benign glands in tissues obtained from patients who have undergone prostatectomy compared to lower expression in the tumor. [score:4]
Taken together, these results show that miR-940 inhibits both the migratory and invasive potential of the cells without affecting cell viability and that these responses are, at least partially, mediated through its regulation of MIEN1. [score:4]
Upon overexpression of miR-940 in DU-145, a decrease was observed in MMP-9, uPA and VEGF, along with pNF-κB S536 (an indicator of nuclear NF-κB that is responsible for the transcription of target genes) at the protein level (Figure  5A,i) compared to the control. [score:4]
MIEN1 is a direct target of miR-940. [score:4]
Binding of the miRNA directly to the 3′UTR of MIEN1 is expected to inhibit the luciferase luminescence compared to the luminescence when the miRNA is unable to bind to the empty luciferase vector control or the MIEN1 3′UTR containing a mutation in the binding site for miR-940. [score:4]
Here, we see that miR-940 expression is highest in the immortalized PWR-1E cells, followed by PC-3 cells and lowest in DU-145. [score:3]
We observed a decrease in the expression of MIEN1 protein by ~3- and ~2-fold in DU-145 (Figure  2A, left) and LNCaP (Figure  2A, right) cells, respectively, when transfected with miR-940 mimic. [score:3]
miR-940 affects target genes in a cellular context dependent manner. [score:3]
No significant differences were observed in the cell viability after 48 or 72 hours of transfection in DU-145 (Additional file 4: Figure S4B), proving that neither miR-940, nor its target MIEN1, has any dramatic effect on cell viability. [score:3]
A novel miRNA, hsa-miR-940 (miR-940), identified and validated to be highly expressed in immortalized normal cells compared to cancer cells, is a regulator of MIEN1. [score:3]
Additionally, the inhibition of endogenous MIEN1 mRNA with ectopic miR-940 in PC-3 decreased MIEN1 transcript. [score:3]
It is also important to determine the different global pathways and the proteins that may be altered by miR-940 that culminates in miR-940 mediated inhibition of prostate cancer progression. [score:3]
Further, ectopic overexpression of miR-940 in PC-3 resulted in a decrease in MIEN1 and its downstream targets, MMP-9, uPA and VEGF compared to the control at the mRNA level (Figure  5D), indicating that the mechanism by which miR-940 affects MIEN1 mRNA is dependent on the amount of miRNA present, which in turn is dependent on the cell type being considered and thus the general cellular context. [score:3]
While in PWR-1E, the endogenous miR-940 potentially degraded MIEN1 mRNA; the overexpression of anti-miR-940 resulted in attenuation of MIEN1 mRNA degradation, thus causing an increase in both MIEN1 mRNA and protein levels. [score:3]
Also, decreased expression of miR-940 in prostate cancer specimens proves the clinical relevance of this miRNA, leading to our belief that miR-940 is a potential diagnostic marker and therapeutic agent. [score:3]
In our study, we performed experiments to determine the effects miR-940 would have on migration and invasion, thus delineating the mechanism by which miR-940 could affect cancer progression, based on its regulation of MIEN1, a validated player in the regulation of prostate cancer migration and invasion. [score:3]
Loss of this serine proteinase inhibitor results in increased risk of lung and liver cancers while its elevated serum levels are associated with prostate cancer [35], supporting our hypothesis that the miR-940 is lost in cancer cells and tissues. [score:3]
Additionally, with the clinical investigations in a small sample cohort, we demonstrated that miR-940 expression is low in tumor, contrary to MIEN1 expression pattern. [score:3]
Consistent with the pattern observed by PCR, the expression of miR-940 in HPV-18C-1 was significantly higher (Figure  1B). [score:3]
Figure 3 miR-940 expression in human prostate cancer and normal tissues. [score:3]
Ectopic expression of miR-940 resulted in not only decreased MIEN1 and its downstream effector molecules, but also reduced the migratory and invasive potential of the cells. [score:3]
Thus, miR-940 may be eliciting the responses we have observed via other targets in addition to MIEN1 and this needs further validation. [score:3]
The expression levels of miR-940 were next examined in a clinical sample cohort of prostate cancer patient tissues by in situ hybridization with miR-940 or scrambled miRNA probe as described in the methods. [score:3]
A scratch wound healing migration assay showed that lesser migration (~0.54-fold) was observed in DU-145 cells treated with miR-940 compared to the non -targeting control 24 hours after the initial scratch (Figure  6A) while this effect was rescued partially (~0.86-fold) when the cells were transfected with MIEN1 ORF plasmid which was non-targetable by miR-940 since it lacks the 3′UTR. [score:3]
Furthermore, using luciferase assays, we ascertained that miR-940 binds directly to the 3′UTR of MIEN1 to cause its suppression. [score:3]
Additionally, the mRNA expression of Slug, a transcriptional regulator of E-cadherin, decreased in miR-940 transfected cells compared to the control (Additional file 5: Figure S5B). [score:3]
This implies that the inhibition of MIEN1 using miR-940 affects MIEN1 in a manner dependent on not only the cellular context (other competitive endogenous mRNA in the specific cells) but also on the endogenous miRNA levels. [score:3]
Since miR-940 is a very novel miRNA whose function has never been validated or reported in any pathway before, in our study we used a set of common genes predicted to be targets of miR-940 by multiple algorithms. [score:3]
Conversely, inhibiting the endogenous miR-940 in PC-3(Figure  2B, left) and PWR-1E (Figure  2B, right) using anti-miR-940 increased the MIEN1 protein by ~4- and ~2-fold, respectively. [score:3]
The expression of miR-221 and miR-324-3p were neither consistently higher in the immortalized cells compared to the cancer cells, nor were they significantly different, together indicating that miR-940 may be the most relevant regulator of MIEN1 among the three miRNAs. [score:3]
Next, we performed northern blotting to confirm the expression levels of the 21nt miR-940 with a biotin-labeled probe. [score:3]
Figure 1 miR-940 expression. [score:3]
As expected, in the small cohort of samples, a statistically significant difference was observed in the expression levels of both miR-940 as well as MIEN1 between the various groups. [score:3]
Since it is known that silencing MIEN1 decreases NF-κB mediated downstream effectors MMP-9, uPA and VEGF [15], we examined if ectopic overexpression of miR-940 had the same effect on downstream effectors of MIEN1. [score:3]
Together, our results indicate that even in a clinical setting (supported by the in vitro data), miR-940 expression is consistently higher in the normal tissues as opposed to the tumor cells. [score:3]
miR-940 attenuates the migration and invasion of prostate cancer cells along with inhibiting their anchorage-independent growth potential. [score:3]
We then examined if miR-940 directly binds to the MIEN1 3′UTR using a luciferase plasmid cloned with MIEN1 3′UTR. [score:2]
Since miR-221, was significantly higher in PC-3 compared to DU-145, we also ectopically expressed miR-221 mimic in DU-145, together with miR-940, or by itself, and observed a decrease in the MIEN1 protein (Figure  2A, left). [score:2]
In PC-3 cells, which express some endogenous miR-940, co-transfection of MIEN1 [WT] plasmid with either the miR-940 mimic or the control miRNA showed significantly lesser luminescence (Figure  4D) compared to the Vec plasmid co-transfections. [score:2]
In this study, we show that MIEN1 undergoes post–transcriptional regulation by miR-940. [score:2]
Next, the invasive potential of the cells was determined using miR-940 mimic or inhibitor transfected DU-145 or PC-3 cells through the transwell matrigel invasion assay system. [score:2]
Our experiments confirmed that MIEN1 is indeed regulated by miRNA and led to the identification and validation of miR-940. [score:2]
This study is the first to identify miR-940 as a novel regulator of MIEN1, a molecule involved in prostate cancer progression. [score:2]
Conversely, the knockdown of endogenous miR-940 in PWR-1E increased protein (Figure  5B,i) and transcript levels (Figure  5B,ii) of MMP-9, uPA and VEGF. [score:2]
Migration Invasion Post-transcription regulation Prostate cancer MicroRNA MIEN1 miRNA-940 Metastatic progression of prostate cancer is a major cause of death among men in the United States [1]. [score:2]
Figure 4 miR-940 directly binds to MIEN1. [score:2]
A recent study implied that miR-940 could be one of the regulators of alpha-1 antitrypsin [34]. [score:2]
These results, for the first time, implicate miR-940, a regulator of MIEN1, as a promising novel diagnostic and prognostic tool for prostate cancer. [score:2]
Next, we wanted to determine if the MIEN1 mRNA stability was altered directly by miR-940. [score:2]
Knockdown of the miR-940 using anti-miR-940 in PC-3 resulted in ~1.8-fold increase in its migratory potential (Figure  6B). [score:2]
Hence, from here on, we only examined the relevance and role of miR-940 in key processes of prostate cancer progression. [score:1]
Additionally, to determine if miR-940 levels vary in benign prostatic hyperplasia (BPH) and metastatic prostate tumors (Mets), we performed in situ hybridization and immunohistochemistry and quantified the staining intensities of miR-940 as well as MIEN1 in these tissues. [score:1]
Our results demonstrate that miR-940 may be a useful diagnostic marker as well as a therapeutic agent for prostate cancer. [score:1]
Our data show that miR-940 decreases the migratory and invasive potential of prostate cancer cells along with facilitation of MET. [score:1]
While, miR-940 alters MIEN1 RNA, in a quantity as well as cell dependent context, along with altering its downstream effectors. [score:1]
Though PC-3 has an increased level of MIEN1 protein upon treatment with anti-miR-940 (Figure  2B, left), there was no increase in the mRNA levels of MIEN1 (Figure  5C). [score:1]
While there were higher levels of miR-940 in the BPH and MN tissues, with a reduction in PCa, the levels were minimal in Mets (Additional file 3: Figure S3B,i). [score:1]
We observed that the miR-940 staining intensity was high (4 and 5) in 12 of the normal tissues, while only 2 out of 15 tumor sections showed staining intensity of 4. Complementarily, 3 of the 15 normal tissues showed a staining intensity of 3 as opposed to tumors exhibiting lower intensities (1, 2, and 3) in 13 of the cases (Figure  3D). [score:1]
Figure 7 miR-940 alters the anchorage -dependent and -independent growth of DU-145 cells. [score:1]
Alterations in mRNA half-life in the presence of the miRNA elucidated the effect of miR-940 on MIEN1 mRNA stability. [score:1]
Here, we show that upon ectopic reintroduction of miR-940, the mRNA as well as protein levels of the effector molecules decrease in DU-145. [score:1]
The Exiqon (Denmark) miRCURY LNA™ microRNA ISH Optimization Kit (FFPE) was used to standardize and perform in situ hybridization, using scrambled miRNA and the 5′- and 3′-DIG double labeled miR-940 probes. [score:1]
Cells were transfected with 3′UTR luciferase constructs (Origene) - Empty Vector (Vec) or 3′UTR-MIEN1 (MIEN1 [WT] / MIEN1 [Mut]) and miR-940 or miR-NT in duplicate. [score:1]
Loss of microRNA, hsa-miR-940, is an indicator of prostate cancer. [score:1]
The considerable morphological difference observed in terms of compactness of the colonies between cells transfected with miR-940 and miR-NT suggested loss of the ability of the miR-940 transfected cells to undergo EMT. [score:1]
Together, this suggests the possible involvement of miR-940 in MET, the reverse process of EMT. [score:1]
Furthermore, to ensure that the effects observed on migration and invasion are a true result of these processes, cell cycle analysis was performed with DU-145 cells transfected with miR-940 and siRNA against MIEN1. [score:1]
Figure 6 miR-940 affects the cellular migratory and invasive potential. [score:1]
Together, the luciferase assays provide direct evidence of miR-940 – MIEN1 mRNA interaction. [score:1]
When MIEN1 3′UTR containing luciferase plasmid (MIEN1 [WT]) was co -transfected with miR-940 in DU-145 (Figure  4B) cells, there was ~2-fold reduction in luminescence as opposed to luminescence from empty luciferase plasmid (Vec) or mutant MIEN1 3′UTR (MIEN1 [Mut]) and miR-940 co-transfections. [score:1]
Though transfection with anti-miR-940 in PC-3 cells showed a statistically significant decrease in cell viability after 48 hours (Additional file 4: Figure S4A) this was only a 15% change and the effect was abrogated after 72 hours. [score:1]
With our in vitro studies, we established the role of miR-940 in several key processes of metastasis; including migration, invasion, anchorage-independent growth and EMT. [score:1]
DU-145 cells were transfected with either miR-940 or the control miRNA and treated with Actinomycin-D (Act-D). [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 188
To further clarify JARID2 is a major effector protein among the endogenous target genes of miRNA-940, we down-regulated JARID2 in the miRNA-940 inhibitor transfected hCMPCs. [score:8]
miRNA-940 was the most down-regulated one with a more than fourfold change between the two examined groups while miRNA-204 was the most up-regulated one (∼3.6-fold). [score:7]
In summary, we identified that miRNA-940 was significantly down-regulated in TOF patients in comparing with the miRNA expression profiles from human samples. [score:6]
As shown in Figure 5 and Figure S9, miRNA-940 inhibitor transfection significantly inhibited migration of hCMPC by 37% while miRNA-940 mimics infection did not affect hCMPCs migration. [score:5]
As shown in Figure S6, neither miRNA-940 mimics nor inhibitor transfection changed the expression levels of cardiomyocyte-specific genes including MEF2C, GATA-4, Nkx-2.5, TropT, βMHC and cActin after 2 weeks of differentiation. [score:5]
Among these dysregulated miRNAs, miRNA-940 was the most downregulated one in individuals with TOF. [score:5]
Figure S6 miRNA-940 mimics and inhibitor do not affect cardiac-specific gene expression under differentiation condition. [score:5]
To confirm that miRNA-940 could endogenously regulate JARID2 expression, the protein level was evaluated in hCMPCs transfected with miRNA-940 mimics, miRNA-940 inhibitor or negative control. [score:4]
Second, hCMPCs transfection experiments were performed followed by western blot to confirm that miRNA-940 could endogenously regulate JARID2 expression. [score:4]
Jumonji, AT rich interactive domain 2 (JARID2) was predicted to be a potential target gene for miRNA-940 and it has been shown to regulate out-flow tract morphogenesis. [score:4]
The down-regulation of miRNA-940 in TOF was validated in 26 independent tissue samples from the right ventricular out-flow tract of patients with TOF (Fig. 2B). [score:4]
miRNA-940 is most significantly down-regulated in TOF patients. [score:4]
The protein level of JARID2 was found to be negatively regulated by miRNA-940, indicating that JARID2 is an endogenous target of miRNA-940 in hCMPCs (Fig. 6B). [score:4]
These results confirm that JARID2 is a direct target gene of miRNA-940. [score:4]
Fig. 5Effects of miRNA-940 mimics and inhibitors on hCMPCs migration. [score:3]
Fig. 8Quantification of the effect on proliferation of JARID2 siRNA trasnsfection in the miRNA-940 inhibitor transfected hCMPCs. [score:3]
Figure S7 Effects of miRNA-940 mimics and inhibitor on differentiation of hCMPCs to cardiomyocyte. [score:3]
Our results showed that JARID2 could affect hCMPC proliferation and migration and suggested they are regulated by miRNA-940 and involved in cardiac development. [score:3]
gr/bioinformatics/projects/GOmir/) was used to identify potential human miRNA-940 target genes. [score:3]
We identified that JARID2 is a target gene of miRNA-940. [score:3]
JARID2 siRNA trasnsfection cancelled the effect of increase of proliferation of hCMPCs as caused by miRNA-940 inhibitor transfection (Fig. 8). [score:3]
Two independent strategies were used to confirm these predicted genes as the targets of miRNA-940. [score:3]
miRNA-940 target gene analysis. [score:3]
Besides promoting proliferation, decreased miRNA-940 also inhibited the migration of hCMPCs. [score:3]
JARID2 is the target gene of miRNA-940. [score:3]
The tissue expression pattern of human miRNA-940 was shown in Figure 2A. [score:3]
Figure S3 miRNA-940 mimics and inhibitor do not affect human cardiomyocyte progenitor cells viability. [score:3]
We further determined the spatial expression pattern of miRNA-940. [score:3]
Cells were transfected with 30 nM miRNA-940 mimics, miRNA-940 inhibitor or negative control in culture medium containing 1% FBS. [score:3]
Fig. 4Effects of miRNA-940 mimics and inhibitors on hCMPCs proliferation. [score:3]
Figure S5 miRNA-940 expression during hCMPC differentiation. [score:3]
Briefly, 500 μl of the hCMPCs suspension at a dosage of 0.3 × 10 [6] cells/ml was transfected with miRNA-940 mimics (30 nM), miRNA-940 inhibitor (30 nM) or the negative control. [score:3]
Quantification of transfection of miRNA-940 inhibitor (A) and miRNA-940 mimics (B) in a serial concentrations from seven independent experiments. [score:3]
We tested serial concentrations of miRNA-940 inhibitor or mimics at the 0, 1, 3, 10 and 30 nM. [score:3]
On the other hand, although miRNA-940 expression level decreased during differentiation of hCMPCs to cardiomyocytes (Fig. S5), modulating miRNA-940 level did not affect hCMPCs differentiation, neither to cardiomyocytes nor to smooth muscle cells. [score:3]
hCMPCs were transfected with siPORT™ NeoFX™ Transfection Agent (Ambion) and miRNA-940 mimics, inhibitor and negative control, according to the manufacturer. [score:3]
Expression profile of (A) miRNA-940; (B) miR-1; (C) miR-133a; (D) miR-133b; (E) miR-499-3p; (F) miR-499-5p; (G) miR-208a; (H) miR-208b in different part of human hearts. [score:3]
Figure S4 miRNA-940 mimics and inhibitor do not cause apoptosis and necrosis. [score:3]
Decreased miRNA-940 promotes hCMPCs proliferation and inhibits hCMPCs migration. [score:3]
Fig. 6 JARID2 is identified as a target gene of miRNA-940. [score:3]
Human cardiomyocyte progenitor cells were transfected with miRNA-940 mimics (30 nM), miRNA-940 inhibitor (30 nM) or the negative control. [score:3]
Figure S8 Effects of miRNA-940 mimics and inhibitors on differentiation of hCMPCs to smooth muscle cells. [score:3]
So we isolated Sca-1 [+] hCMPCs as an in vitro system to carry out the functional study of the role of miRNA-940 in regulating proliferation, migration and differentiation on the human cardiac derived progenitor cells. [score:2]
We further counted the number of EdU incorporated cells, miRNA-940 inhibitor transfection increased hCMPCs proliferation by 61% while miRNA-940 mimics transfection led to a significant up to 40% decrease in cellular proliferation compared with control cells (Fig. 4C and D). [score:2]
Such increases again support the negative regulation of miRNA-940 on JARID2. [score:2]
miRNA-940 is only observed in human, macaca mulatta, pan troglodytes and bos taurus, making its extremely hard to generate genetically modified mouse mo dels to study TOF development or progression. [score:2]
Furthermore, compared to well-known cardiac or muscle specific miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-499-5p and miR-499-3p), miRNA-940 was the only one which is most highly expressed in the normal human right ventricular out-flow tract comparing to other chambers within the heart (Fig. 3). [score:2]
miRNA-940 inhibitor transfection (30 nM) significantly increased hCMPCs proliferation while miRNA-940 mimics transfection (30 nM) led to a significant decrease in cellular proliferation compared with control cells (Fig. 4A and B). [score:2]
Our finding uncovers an essential role of miRNA-940 in cardiac development and may offer new insight into the pathogenesis of TOF. [score:2]
miRNA-940 reduction disturbs the proliferation and migration of the progenitor cells of the secondary heart field, potentially by modulating JARID2 and ultimately contributing to human TOF. [score:1]
Decreased miRNA-940 did not affect differentiation of hCMPCs to either cardiomyocytes or smooth muscle cells as well. [score:1]
miRNA-940 mimics (Cat. [score:1]
22, the miR-940 function is less likely to be impaired. [score:1]
An end -labelled (Exiqon, Vedbaek, Denmark) oligonucleotide probe for miRNA-940 (GGGGAGCGGGGGCCCTGCCTT) was hybridized to the filter in Rapidhyb buffer (Amersham Biosciences). [score:1]
There results indicated that miRNA-940 may be associated with human TOF. [score:1]
These results indicate an interlink between decreased miRNA-940 and human TOF. [score:1]
However, the precise mechanism of how decreased miRNA-940 contributed to TOF remains unclear. [score:1]
We found that miRNA-940 was highly enriched in human cardiac tissue, particularly in the right ventricular out-flow tract. [score:1]
In addition, stainings for α-actin and Nkx2.5 also indicated that miRNA-940 did not affect hCMPCs differentiation into cardiomyocytes (Fig. S7). [score:1]
Collectively, these results show that decreased miRNA-940 changed the proliferation and migration of hCMPCs, which potentially contributes to the genesis of TOF. [score:1]
Moreover, the qRT-PCRs and western blot for α-SMA and calponin consistently showed that miRNA-940 did not affect hCMPCs' differentiation to smooth muscle cells (Fig. S8). [score:1]
miRNA-940 function was explored by cell transfection experiment. [score:1]
miRNA-940 transfection experiments. [score:1]
Further work is warranted to define the miRNA-940 network. [score:1]
Figure S2 Efficiency of the miRNA-940 transfection. [score:1]
It was found that decreased miRNA-940 promoted hCMPCs proliferation, but did not affect cell viability apoptosis or necrosis. [score:1]
To validate that miRNA-940 is cardiac specific or enriched, total RNAs from human tissues including lung, pancrease, heart, brain, kidney, skeletal muscle, spleen, liver, bladder, stomach, colon, intestine (Applied Biosystems) were separated on a 10% acrylamide TBE-urea mini-gel (Applied Biosystems) and then electroblotted onto Hybond N+ nylon filter (Amersham Biosciences, Amersham, UK). [score:1]
The constructs with the miRNA-940 binding site deleted has no effect on the luciferase activity. [score:1]
Figure S9 Effects of miRNA-940 mimics and inhibitor on hCMPCs migration as assayed by the chamber assay. [score:1]
Our results did provide evidence for the potential pathogenic role of miR-940 in TOF. [score:1]
[1 to 20 of 70 sentences]
3
[+] score: 175
Other miRNAs from this paper: hsa-mir-299
We found that miR-940 mimic inhibited lncHERG expression while miR-940 inhibitor enhanced lncHERG expression (Figure 5C). [score:9]
Besides, we found that miR-940 overexpression decreased the mRNA levels of lncHERG and overexpressing lncHERG also inhibited the expression of miR-940. [score:9]
Consistently, lncHERG knockdown promoted the expression of miR-940 while overexpressing lncHERG inhibited that of miR-940 (Figure 5D). [score:8]
We found that transfection with miR-940 inhibitor promoted cell migration and invasion while lncHERG knockdown inhibited migration and invasion (Figure 6D and 6E). [score:6]
To further confirm it, we analyzed the expression of miR-940 in 80 pairs of glioblastoma tissues and found that miR-940 was also down-regulated in tumor tissues (Figure 5F). [score:6]
Then we found that miR-940 was down-regulated in glioblastoma compared to non-tumor tissues, which indicated that miR-940 may also act as a tumor suppressor. [score:5]
And miR-940 suppresses cell invasion and migration in HCC by targeting CXCR2 [23]. [score:5]
In different cancers, miR-940 seemed to target respective target. [score:5]
To demonstrate it, we conducted MTT assays, we found that lncHERG knockdown inhibited cell proliferation while addition of miR-940 inhibitor reversed it in U87 and 251 cells (Figure 6A). [score:5]
Therefore, miR-940 acted as a tumor suppressor in glioblastoma and was a target of lncHERG. [score:5]
The expression of miR-940 was down-regulated in GBM tissues compared to peritumor tissues. [score:5]
Besides, we checked the correlation of lncHERG expression with miR-940 expression in glioblastoma. [score:5]
We found that miR-940 mimic dramatically inhibited the luciferase activity while miR-940 inhibitor promoted the activity (Figure 5B), which demonstrated that lncHERG can bind to miR-940. [score:5]
We wondered whether miR-940 was also a tumor suppressor and whether lncHERG inhibited tumor growth by sponging miR-940 in glioblastoma. [score:5]
Figure 6 (A) lncHERG knockdown inhibited cell proliferation while overexpression of miR-940 mimic in the meantime reversed this trend as shown by MTT assays. [score:5]
For example, miR-940 inhibited cell proliferation and apoptosis in ovarian cancer by targeting PKC-δ [22]. [score:5]
LncHERG knockdown impaired cell proliferation, migration and invasion while inhibition of miR-940 in the meantime reversed it. [score:4]
To determine whether miR-940 is also a tumor suppressor in glioblastoma and whether lncHERG promoted tumor growth by inhibiting miR-940, we first conducted luciferase assays. [score:4]
Moreover, miR-940 inhibition promoted cell entry into cell cycle even under the condition of lncHERG knockdown (Figure 6C). [score:4]
In summary, we screened out a unidentified lncRNA lncHERG that regulated tumor development and progression in glioblastoma by directly sponging miR-940. [score:4]
In a word, lncHERG sponged miR-940 which was down-regulated in glioblastoma. [score:4]
miR-940 was reported to act as a tumor suppressor. [score:3]
The target genes of miR-940 in glioblastoma remain to be explored further. [score:3]
Some miRNAs were the potential targets of lncHERG, but miR-940 scored top. [score:3]
Moreover, we found that miR-940 was down-regulated in glioblastoma compared to non-tumor tissues according to an online dataset (GSE90605) (Figure 5E). [score:3]
On the other hand, lncHERG depletion promoted cell apoptosis while miR-940 inhibition in the meantime decreased apoptosis (Figure 6F). [score:3]
Then we transfected miR-940 mimic or inhibitor into U87 or U251 cells and checked mRNA levels of lncHERG. [score:3]
We found that the expression of lncHERG was negatively correlated with that of miR-940 in 80 glioblastoma samples (Figure 5G). [score:3]
We found that miR-940 mimic inhibited luciferase activity. [score:3]
For lncHERG and miR-940 interaction, cells were co -transfected with wild-type, mutated lncHERG reporter plasmid or pRL-TK vector, and miR-940 mimics or miR-940 inhibitor. [score:3]
miR-940 mimic remarkably inhibited luciferase activity. [score:3]
Moreover, previous studies showed that miR-940 served as a tumor suppressor in various cancers including human nasopharyngeal carcinoma, prostate cancer, pancreatic ductal adenocarcinoma, hepatocellular carcinoma, ovarian cancer and triple -negative breast cancer [22, 24– 26, 34, 35]. [score:3]
Besides, lncHERG silence impaired colony formation while addition of miR-940 inhibitor in the meantime promoted the ability of colony formation (Figure 6B). [score:3]
Besides, miR-940 also inhibited triple -negative breast cancer, pancreatic ductal adenocarcinoma and prostate cancer [24– 26]. [score:3]
Moreover, miR-940 was down-regulated in glioblastoma tissues compared to peritumor tissues. [score:3]
However, addition of miR-940 inhibitor in the meantime fully reversed these trends. [score:3]
We then conducted luciferase activity assays by transfecting pRL-lncHERG-wt or pRL-lncHERG-mut together with miR-940 mimic or inhibitor into 293T cells. [score:2]
All above indicated that lncHERG directly bond to miR-940 in glioblastoma. [score:2]
However, the function of miR-940 in glioblastoma remains elusive. [score:1]
In summary, our study highlights the essential role of lncHERG in glioblastoma by acting as a competing endogenous RNA of miR-940, which may serve as a new prognostic biomarker in glioblastoma. [score:1]
Our research revealed the pivot role of lncHERG/miR-940 axis in glioblastoma, which may provide a new sight on the treatment of glioblastoma. [score:1]
Nevertheless, the role of miR-940 in glioblastoma is totally unknown. [score:1]
Figure 5 (A) A diagram for the binding site with miR-940 in lncHERG and construction of lncHERG mutant was shown. [score:1]
We found that there are 21 potential binding sites with miR-940 in lncHERG, which strongly indicated that lncHERG may sponge miR-940. [score:1]
LncHERG sponges miR-940 in glioblastoma. [score:1]
Taken together, lncHERG promoted cell proliferation, migration and invasion by sponging miR-940 in glioblastoma (Figure 6G). [score:1]
In mechanism, we found that lncHERG sponged miR-940 in glioblastoma. [score:1]
We found that there are 21 potential binding sites with miR-940 in lncHERG (Figure 5A). [score:1]
We also checked the influence of miR-940 on migration and invasion. [score:1]
LncHERG promoted cell proliferation, migration and invasion by sponging miR-940 in glioblastoma. [score:1]
We have validated that lncHERG bond to miR-940 in glioblastoma. [score:1]
[1 to 20 of 51 sentences]
4
[+] score: 70
Recently, Su et al. reported that miR-940 expressions were upregulated in cervical cancer tissue samples and cell lines and induced cervical cancer cell growth, proliferation and cell cycle arrest in vitro as well as tumor formation in vivo via suppression of p27 and PTEN expressions [42]. [score:10]
This may be a therapeutic target for cervical cancer treatment in the future by inhibition of candidate miRNAs including miR-940 using antisense oligonucleotide to block endogenous miRNA function for enhancement of immune cell function and inhibition of tumor cell growth and proliferation. [score:7]
It is consistent to our study that miR-940 was highly expressed in cervical cancer cell lines and cloud down regulate MICB expression in cancer cells leading to immune surveillance escape and surviving in the host. [score:6]
These results indicated that overexpression of the candidate miRNAs (miR-302c, miR-320a, miR542-3p, miR-641, miR-661 and miR-940) could, indeed, reduce the surface expression of MICB protein. [score:5]
MiR-320a, miR-320b and miR-940 were expressed in all cell lines whereas miR-320c was only expressed in KKU-214 (Figure 1B). [score:5]
Su K. Wang C. F. Zhang Y. Cai Y. J. Zhang Y. Y. Zhao Q. Mir-940 upregulation contributes to human cervical cancer progression through p27 and PTEN inhibitionInt. [score:5]
Thus, we concluded that candidate miRNAs (miR-320a and miR-940) genuinely regulated MICB expression. [score:4]
Finally, we concluded that not only MICB expression was regulated by miR-320a and miR-940 but could also be controlled by other candidate miRNAs such as miR-302c, miR-542-3p, miR-641 and miR-661. [score:4]
Overexpression of candidate miRNAs in HeLa was performed by transfection with miRNA mimic vectors (miR-302c, miR-320a, miR542-3p, miR-641, miR-661 and miR-940) or control mimic vector. [score:3]
The overexpressing miRNA mimic vectors (miR-302c, miR-320a, miR-542-3p, miR-641, miR-661 and miR-940 mimics) were transiently transfected into 293T cells and were co -transfected with luciferase reporter constructs containing wild-type 3-′UTR of MICB (pMICB_3U). [score:3]
Consequently, to confirm hypothesis of these studies we constructed plasmids to overexpress candidate miRNAs (miR-302c, miR-320a, miR-542-3p, miR-641, miR-661 and miR-940 mimic) and then these mimic miRNAs or control mimic plasmids were co -transfected with reporter construct containing wild-type 5′-UTR (pMICB_5U) into 293T cells. [score:3]
As mentioned previously, miR-320a and miR-940 were expressed at high levels in several cell lines especially in KKU-214. [score:3]
Thus, the candidate miRNAs (miR-302c, miR-320a, miR-542-3p, miR-641, miR-661 and miR-940) could regulate 5′-UTR of MICB by direct binding. [score:3]
The surface expression of MICB was increased in the anti-miR- 320a and anti-miR-940 treated KKU-214 compared to the scramble controls (Figure 5B,C). [score:2]
These results indicated that miRNA candidates (miR-320a, miR-542-3p, miR641, miR-940, miR-302c and miR-661) interacted with a predicted binding site on 3′-UTR of MICB. [score:1]
miR-542-3p and miR-940 have binding sites on the core promoter, initiator element (Inr) that has function similar to TATA in facilitating TATA binding protein or the transcription factor II D (TFIID) [40]. [score:1]
KKU-214 cells were seeded at 5 × 10 [4] cells/well in 24-well plates and cultured until 70–80% confluent cell growth then transfected with 500 nM of anti-miR-320a, anti-miR-940 or the scramble control (mirVana [TM], Applied Biosystems) by using FuGene [®] HD transfection reagent (Roche) according to the manufacturer’s instructions. [score:1]
Moreover, the exogenous miR-320a and miR-940 could also reduce luciferase activities (Figure 3C,E,G). [score:1]
KKU-214 cells were transfected with anti-sense miR-320a, anti-sense miR-940 or the scramble control. [score:1]
One type of constructs contained the mutated binding sites of both known miRNAs (miR-20a, miR-93 and miR-106b) and nine novel miRNAs (our candidate miRNAs, miR-320c, miR-320a, miR-320b, miR-320c, miR-320d, miR-542-3p, miR-641, miR-661 and miR-940) and another type contained only the mutated binding sites of known miRNAs as a positive control (Figure 3A). [score:1]
The miR-320a and miR-940 levels were reduced 90% and 55%, respectively, lower than the endogenous miRNAs (Figure 5A). [score:1]
[1 to 20 of 21 sentences]
5
[+] score: 60
As for miR-940, its upregulation by transfection with miR-940 vector can inhibit cell proliferation and induce apoptosis by targeting PKC-δ in ovarian cancer (35). [score:8]
However, overexpression of miR-940 promoted cell migration, invasion, and metastasis by repression of zinc finger protein 24 expression in gastric cancer (39), and accelerated cell growth, proliferation and cell cycle arrest by the inhibition of p27, phosphatase and tensin homolog in cervical cancer (40). [score:7]
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
miR-940 may suppress tumor cell invasion and migration via regulation of the migration and invasion enhancer 1 protein in prostate cancer (36), the inhibition of phosphorylation of myosin II in breast cancer (37), and the regulation of CXC chemokine receptor 2 in hepatocellular carcinoma (38). [score:7]
A total of 2,655 target genes of miR-940 and 995 target genes of miR-486-5p, co-predicted with the five software programs used, were selected for GO enrichment and KEGG pathway analyses. [score:5]
In the qPCR analysis, the relative expression of miR-940 showed a significant upregulation in patients with SCH + SA compared with those with SCH or SA, and HC (p < 0.05, Figure 2). [score:5]
Significant differences in miR-940 expression were not found between patients with SCH and HC or between patients with SA and HC. [score:3]
MicroRNA-940 suppresses prostate cancer migration and invasion by regulating MIEN1. [score:3]
Interestingly, as displayed in Figure 4, miR-486-5p expression was positively correlated with TSH levels (r = 0.275, p < 0.05), whereas an association between serum miR-940 and TSH levels was not found (p > 0.05). [score:3]
Figure 4Correlation analysis of differentially expressed microRNAs, miR-940 (A) and miR486-5p (B), and thyroid-stimulating hormone (TSH) levels; p < 0.05 was considered significant. [score:2]
The expression of miR-940 was also significantly elevated in patients with SCH + SA compared with those with SCH or SA, and HC. [score:2]
miR-940 and miR-486-5p (Figure 5A) had the following areas under the ROC curve: 0.763 (p < 0.01) and 0.720 (p < 0.01), respectively, which distinguished patients with SCH + SA from the other groups (SCH, SA, and HC). [score:1]
Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1). [score:1]
We showed that miR-940 was significantly more elevated in patients with SCH + SA than in patients with SCH or SA, or HC. [score:1]
There is no evidence concerning the role of miR-940 in miscarriage or SCH as yet. [score:1]
In conclusion, our study first identified two miRNAs (miR-486-5p and miR-940) that showed differences in serum levels in SCH, SA, and SCH combined with SA groups of patients. [score:1]
Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups. [score:1]
In addition, using miR-940 and miR-486-5p alone, we could distinguish patients with SCH + SA from the SCH, SA and HC groups. [score:1]
As Figure 5B demonstrates, miR-486-5p had an AUC (0.717, p = 0.01), which distinguished all patients with SCH (SCH + SA and SCH) from the other groups (SA and HC); however, miR-940, with an AUC of 0.617 (p > 0.05), could not be used make this distinction. [score:1]
[1 to 20 of 19 sentences]
6
[+] score: 57
Strikingly, the ectopic expression of miR-661 strongly modified the spatial phosphorylation of myosin II, while in contrast, overexpression of either miR-612 or miR-940 inhibited myosin II phosphorylation (Figure 3). [score:7]
Interestingly, miR-940 is moderately to highly expressed (pink to red node) in 7 tissues out of 8 whereas miR-661 and miR-612 both show little or no expression (white node) in the same tissues. [score:5]
This absence might be explained by the fact that miR-940 is never one of the most differentially expressed microRNA in these datasets even though its expression trend is consistent. [score:5]
Interestingly, miR-940 was found consistently downregulated in breast cancer (log fold change of −0.26 on GSE44124, -0.53 on GSE31309, and -0.57 on GSE38867). [score:4]
To our knowledge, miR-940 had never been reported as differentially express in breast cancer. [score:3]
Expression of miR-940 on three datasets of human breast cancer taken from GEO (GSE38867, GSE44124 and GSE31309). [score:3]
With an image -based phosphorylation quantification, we observed that the overall phosphorylation level of MLCII was only significantly reduced with the overexpression of miR-612 and miR-940 (P-values = 0.04 and 1.2 × 10 [−5], respectively) (Figure 3d). [score:3]
Lastly, 7 hubs from the 11 hubs discovered by DIANA-microT are retrieved within the 40 degree sorted nodes on the TargetScan network (in decreasing order by degree: miR-548c-3p, miR-590-3p, miR-579, miR-186, miR-513a-3p, miR-661, miR-495 and lastly miR-940). [score:3]
Relative expression of miR-940 in breast cancer. [score:3]
On two out of three microarray sets, miR-940 is differentially expressed with high significance based on limma analysis (p-Value < 0.001). [score:3]
Each condition (miR-612, miR-661, miR-940, and siRNA-AllStars) was represented in triplicate, leading to 30 observations per experiment and per condition (Supplementary Figure S14). [score:1]
Effect of miR-612, miR-661 and miR-940 on RPE1 migration and proliferation. [score:1]
Involvement of miR-661, miR-612 and miR-940 in small GTPase signalling. [score:1]
The 5 microRNAs are, in decreasing order of centrality: miR-548c-3p, miR-590-3p, miR-661, miR-186 and miR-940. [score:1]
RPE1 cells were transfected with miR-612, miR-661 or miR-940 mimics and immunolabeled for phosphomyosin II and actin fibres on 1000 µm [2] circular fibronectin patterns. [score:1]
is composed of 3 microRNAs (Supplementary Table IV), namely miR-940, miR-661 and miR-612. [score:1]
After data normalisation, the package Limma 67 was used to calculate P-values for differential expression of miR-940 in breast cancer tissues against normal tissues. [score:1]
The second central hub group, named “assorted club 2”, was composed of miR-612, miR-661 and miR-940. [score:1]
These data are consistent with our previous results on the role of miR-940 in cell dynamics and might shed light on a probable role of this microRNA in breast cancer progression. [score:1]
The microRNA mimics (miR-612, miR-940 and miR-661) were purchased from Thermo Scientific (Waltham, Massachusetts) Dharmacon (miRIDIAN). [score:1]
To pool the four experiments together, each condition of each experiment was normalised to the median number of cells in the siRNA-AllStars condition (), considering all replicates: where N is the number of counted cells and Ñ the normalised number of cells for each condition, replicate and experiment; x is the experiment (1, 2, 3 or 4), r, the replicate for each experiment (1, 2 or 3), and, the different conditions (siRNA-AllStars or mimics of miR-612, miR-661 or miR-940). [score:1]
RPE1 cells were seeded in six-well microtiter plates, cultured for one day, and then transfected with mimics of miR-612, miR-661, or miR-940 or with a negative control siRNA (siRNA AllStars) at a final concentration of 20 nM. [score:1]
In contrast, there was a decrease in actin staining following miR-612 and miR-940 treatment (P-values = 0.031 and 1.2 × 10 [−5], respectively). [score:1]
RPE1 cells were independently transfected with mimics of miR-661, miR-612 and miR-940. [score:1]
Furthermore, Figure 3c shows that upon transfection of miR-612 and miR-940 mimics, the cells were relaxed and exhibited the same behaviour as the cells treated with Y27632. [score:1]
miR-940 is located on chromosome 16, miR-661 on chromosome 8, and miR-612 on chromosome 11 (Supplementary Figure S5). [score:1]
Assorted club 2 is composed of 3 microRNAs (Supplementary Table IV), namely miR-940, miR-661 and miR-612. [score:1]
RPE1 cells were transfected with AllStars siRNA or mimics of miR-612, miR-661 or miR-940 at 20 nM for 48 h. The positive control (Y27632) was added to the siRNA AllStars -transfected cells at 10 µM for the last 24 h. The transfected cells were then plated on the micropatterns. [score:1]
[1 to 20 of 28 sentences]
7
[+] score: 16
Other miRNAs from this paper: hsa-mir-31, hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-525
Interestingly, a recent study shows that miR940 is up-regulated in gastric cancer and promotes gastric cancer migration and invasion by targeting tumor suppressor ZNF24 [84]. [score:8]
First, differential expression levels of ZNF proteins in different cancer types are regulated by cancer-related miRNA, including miR-199a-3p, miR-525-3p, miR-940 and miR-31. [score:4]
Differential expression of ZNF proteins in different cancer types can be regulated by 1) cancer-related miRNAs, including miR-199a-3p, miR-525-3p, miR-940 and miR-31, or 2) different environmental stimuli, which activate signaling cascades and therefore fine-tune ZNF protein functions through various of PTMs, including phosphorylation (P) and acetylation (Ac). [score:4]
[1 to 20 of 3 sentences]
8
[+] score: 13
For 4 of the 5 miRNAs with significant target association to the HD canonical pathway, we confirmed their expression by qPCR in the monkey cortical tissues (miR-940 did not have commercially available Taqman primers for qPCR) (Figure  1D). [score:4]
Furthermore, several of the dysregulated miRNAs in the HD monkeys are also predicted to target the insulin like growth factor −1 gene (IGF1) or its receptor (IGF1-R), including; miR-128a, miR940, miR-320, and miR133. [score:4]
MiR-940, one of the 11 HD -associated miRNAs in the transgenic monkeys, is also predicted to target HTT. [score:3]
D) qPCR validation for the expression of 4 of the 5 miRNAs with significant Ingenuity analysis association to the HD pathway (miR-940 also showed association with the HD pathway, however, no Taqman assays were commercially available). [score:2]
[1 to 20 of 4 sentences]
9
[+] score: 12
Eight up-regulated miRNAs, including miR-19a-3p, miR-877-3p, miR-148a-3p, miR-212-5p, miR-1825, miR-210-3p, miR-940, and miR-134-5p, and two down-regulated miRNAs, miR-3609 and miR-145-5p, were identified as statistically significant different miRNAs. [score:7]
Decreased miR-940 in hepatocellular carcinoma acted as an adaptor of CXCR2 and suppressed the invasion and migration of HCC cells[19]. [score:3]
Considering that the conversion of the biological functions of normal cells is fundamental to the pathology of PE and carcinoma, we infer that miR-877-3p, miR-212-5p, miR-1825, miR-940, miR-134-5p, and miR-3609 might take part in the progression of PE. [score:1]
No studies on the relationship between the other miRNAs, miR-877-3p, miR-212-5p, miR-1825, miR-940, miR-134-5p, and miR-3609, and PE have been reported. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 11
MiR-940 was found as most down-regulated and miR-204 as most up-regulated miRNA [9, 10, 13]. [score:7]
Among the altered miRNAs, miR-940 was the most down-regulated one [13]. [score:4]
[1 to 20 of 2 sentences]
11
[+] score: 9
Downregulated HRMs were striking in that for the most part they displayed an associated lack of known targets in hMSC biology but miRs- miR-1246, -4484, -1909-3p, -3135b and miR-940 are known to target Nuclear factor 1 B-type or NFIB which plays a role in the promotion of cortical development and neuronal differentiation [55]. [score:9]
[1 to 20 of 1 sentences]
12
[+] score: 6
Other miRNAs from this paper: hsa-mir-3679
The authors observed significant down-regulation of miR-3679-5p and up-regulation of miR-940 in the cancer group compared to the other groups (Table 1), suggesting salivary miRNA may potentially be used for early detection of pancreatic cancer. [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 5
83 *** hsa-mir-346 7.13 *** 69.13 *** hsa-mir-361-3p 4.51 *** 9.6 *** hsa-mir-483-3p 3.56 *** 68.61 *** hsa-mir-486-5p 2.85 *** 34.48 *** hsa-mir-574-3p 2.61 *** 43.22 *** hsa-mir-629* 16.62 *** 67.23 *** hsa-mir-885-5p 4.75 *** 43.73 *** Inhibited differentiation & high cell count hsa-mir-193b 38.04 *** 102.74 * Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-369-3p 61.75 *** 103.6 * hsa-mir-381 61.75 *** 105.31 * hsa-mir-886-5p 38.04 *** 112.86 *** hsa-mir-940 21.37 *** 112.35 *** Enhanced differentiation hsa-mir-98 104.51 * 87.82 *** High cell count hsa-mir-631 92.63 ** 103.43 *** 1see Material and Methods; 2 *: p<0.05; **: p<0.01; *** p<0.005; − = not significant. [score:3]
MiR-940 inhibition, on the other hand, consistently resulted in a 10% higher number of cells than in the control populations. [score:2]
[1 to 20 of 2 sentences]
14
[+] score: 5
Specifically we show that the strong female specific expresser: hsa-miR-940 to be detected in the cervix [29] (Fig. S4). [score:3]
Through an analysis of intensity distributions and q-value estimates [24], we find all of the 4 miRNAs (hsa-miR-548-3p, hsa-miR-1323, hsa-miR-940 and hsa-miR-1292) to be significantly up regulated in females with a 1.63 to 1.94 fold-change in intensity levels (Fig. S4). [score:2]
[1 to 20 of 2 sentences]
15
[+] score: 5
The mature sequence of miR-940, which has been shown to target the signaling gene SEMA3F [21], contains an in del (rs3536504) that may disrupt the binding of miR-940 to SEMA3F and other targets. [score:5]
[1 to 20 of 1 sentences]
16
[+] score: 5
Other miRNAs from this paper: hsa-mir-142, hsa-mir-30e
ALZ dataset consists of 16 matched miRNA and gene expression experiments, obtained by USC/XJZ Human 0.9 K miRNA-940-v1.0 and Affymetrix Human Genome U133 Plus 2.0 Array, in parietal lobe tissue from 4 Alzheimer Disease patients and 4 age-matched controls (GSE16759) [41]. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
For the efficient target SH2B3, miR-940 repressed it only in CIN I stage, and it had contribution to the ‘embryonic hemopoiesis’ process only in CIN III stage. [score:3]
Our finding suggests that due to miR-940’s differential regulation on SH2B3, the angiogenesis process may be promoted in CIN III stage. [score:2]
[1 to 20 of 2 sentences]
18
[+] score: 4
Among all of the TGF-β pathway-related miRNAs, five known miRNAs (miR-3180-3p, miR-34b-5p, miR-877-3p, miR-936, and miR-940) and 10 novel miRNA candidates (seq-915_x4024, seq-5118_x304, seq-6713_x208, seq-14465_x69, seq-18595_x48, seq-19788_x44, seq-38785_x17, seq-38875_x17, seq-48658_x13, and seq-52107_x11) target pathway members that positively regulate the pathway. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 4
We determined the expression of angiogenesis-related miRNAs (miR-20a, miR-126, miR-210, miR-221, miR-222, miR-328; Dews et al., 2006; Poliseno et al., 2006; Kuehbacher et al., 2007; Fasanaro et al., 2008; Soeki et al., 2016), inflammation-related miRNAs (miR-21, miR-146a, miR-155; Taganov et al., 2006; Urbich et al., 2008; Wang et al., 2017) and cardiac or muscle-specific/enriched miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-378, miR-486, miR-499, miR-940; Chen et al., 2006; Soci et al., 2016; Xu et al., 2016). [score:3]
Circulating miR-21, miR-378, and miR-940 increase in response to an acute exhaustive exercise in chronic heart failure patients. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 4
Deregulation of a number of miRNAs in our study have been previously reported in right and left atrial appendages of patients with rheumatic mitral valve disease (RMVD), including miR-222-3p, miR-4484 and miR-940 in left atrial appendage [41], miR-5190 and miR-23c in right atrial appendages [42] and miR-143-3p in both, in the LAA and RAA of patients with RMVD [43]. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 4
MiR-940 and miR-1827 were predicted by TargetScan and miRPath, have shown binding site at position 413–419 and 305–315 respectively of 3′-UTR for the same gene, to down regulate the Treg-specific differentiation (Figure 2). [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 3
Our results reported 42 differentially expressed miRNAs in PBLs cultured for 24 h in MMG with respect to 1 g, of which 14 (miR-34a-5p, miR-34b-5p, miR-663a, miR-135a-3p, miR-1225-5p, miR-940, miR-221-5p, miR-29b-1-5p, miR-10a-5p, let-7i-3p, miR-200a-3p, miR-7-5p, miR-7-1-3p, and miR-505-5p) were found altered also by γ-irradiation, as assessed in our previous study [47]. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
7. Liu, X. et al. MicroRNA-940 promotes tumor cell invasion and metastasis by downregulating ZNF24 in gastric cancer. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
In addition, miR-379-5p, miR-940, and miR-34a-5p containing variants in the mature sequence also displayed partial or total loss of function of their original mRNA targets tested. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
Other miRNAs from this paper: hsa-mir-498
Myoma discs are used to compare the invasion of parental and transduced cell lines, such as MMP-8, endostatin, urokinase plasminogen activator receptor (uPAR) and trypsin-2 overexpressed, or cathepsin K, snail, miRNA-498 and miRNA-940 silenced carcinoma cell lines [39, 54, 68, 71, 75– 77]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
34 hsa-miR-335 −0.35hsa-miR-345 [44], [53], [71] 1.16 hsa-miR-363 0.99 hsa-miR-371-5p 0.55 hsa-miR-421 0.50 hsa-miR-483-5p 1.33 hsa-miR-494 0.87 hsa-miR-505* −0.40 hsa-miR-513a-5p 1.06 hsa-miR-513b 1.19 hsa-miR-513c 1.22 hsa-miR-551b −0.40 hsa-miR-574-5p 0.97hsa-miR-630 [68], [73] 0.96 hsa-miR-769-5p −0.34 hsa-miR-801 0.66 hsa-miR-873 −0.64 hsa-miR-877* 0.72 hsa-miR-923 0.89 hsa-miR-940 0.49 hsa-miR-95 −0.44 hsa-miR-99a −0.64Irradiated and non-irradiated PBL of the same donors were incubated in static gravity (1 g) for 4 and 24 h, and miRNA expression profile was analyzed at the end of each incubation time. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
Increasing evidence has indicated the diagnostic value and clinical implications of several miRNAs in heart diseases, such as miR-433, miR-21, miR-378, and miR-940 [19– 21]. [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
unst) TGF-beta signaling pathway miR-106b, −132, −148b-5p, −182, −212, −374a, −548j 1.75E-07 TGFBR2, TGFB2, SMAD2, SMAD3, SMAD4, BMPR2 Axon guidance miR-22-5p, −30b, −31, −33a-3p, −182, −132, −550a 2.85E-06 EFNB1, DCC, EPHB4, EPHA3, PLXNA1, PAK4 MAPK signaling pathway miR-30b, −106b, −132, −182, −212, −548j, −202-5p 6.43E-05 MAP3K1, MAP3K5, KRAS, MRAS, GRB2, FGF7 Endocytosis miR-33a-3p, −106b, −182, −374a, −374b, −202-5p 3.83E-04 RAB11FIP4, RAB11FIP2, EEA1, IGF1R, EPS15, EPN Colorectal cancer miR-30b, −33a-3p, −106b, −132, −212, −384, −494 5.94E-04 SOS1, FZD3, SMAD2, DCC, MAPK1, BAX Pathways in cancer miR-33a-3p, −107, −132, −212, −494, −495, −548j 5.95E-04 E2F1, FGF18, WNT16, FGF7, PTEN, MITF Wnt signaling pathway miR-132, −212, −33a-3p, −494, −940, −495, −548j, −107 6.73E-04 LRP5, LRP6, TCF7, PLCB4, DVL3, WNT1, WNT5A Neurotrophin signaling pathway miR-106b, −30b, −940, −182, −212, −107, 0.001267 PIK3R2, NTRK2, NTRK3, RPS6KA6, IRS1, RAC1 Oocyte meiosis miR-212, −132, −940, 495, −595, −107 0.003369 CDC27, CPEB1, PRKACB, FBXW11, MAPK1, RPS6KA3 GnRH signaling pathway miR-940, −495 0.007085 PRKCA, SRC, MAP3K2, MAPK14, GRB2, MAP3K3 Underexpressed miRNAs (Hyp vs. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 3
Eleven miRNAs (miRNA-4530, miRNA-4739, miRNA-762, miRNA-4787-5p, miRNA-940, miRNA-3676-5p, miRNA-6090, miRNA-150-5p, miRNA-4516, miRNA-4284, miRNA-3656) demonstrated a similar expression trend in both the acute and chronic groups. [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Other miRNAs from this paper: hsa-mir-22, hsa-mir-25, hsa-mir-361, hsa-mir-363
Recently, it has been reported that miR-940, miR-363, miR-25, and miR-269-5p function as oncogenes in gastric cancer [10– 12], whereas miR-22, and miR-361-5p function as tumor suppress genes [13– 15]. [score:3]
[1 to 20 of 1 sentences]
31
[+] score: 2
Table 1 Candidate reference genes for microRNA normalisation microRNA Sequence PubMed ID miR-17-5p CAAAGUGCUUACAGUGCAGGUAG 18375788 miR-24-3p UGGCUCAGUUCAGCAGGAACAG 22074795 miR-26b-5p UUCAAGUAAUUCAGGAUAGGU 18718003 miR-93-5p CAAAGUGCUGUUCGUGCAGGUAG2213452918375788 miR-103a-3p AGCAGCAUUGUACAGGGCUAUGA221345292151918418375788 miR-106a-5p AAAAGUGCUUACAGUGCAGGUAG1837578822788411 miR-130b-3p CAGUGCAAUGAUGAAAGGGCAU 20890088 miR-151a-5p UCGAGGAGCUCACAGUCUAGU 22745731 miR-191-5p CAACGGAAUCCCAAAAGCAGCUG221345292151918418375788 miR-221-3p AGCUACAUUGUCUGCUGGGUUUC 21567136 miR-425-5p AAUGACACGAUCACUCCCGUUGA 20429937 miR-940 AAGGCAGGGCCCCCGCUCCCC 24488924 let-7d-5p AGAGGUAGUAGGUUGCAUAGUU 24223986 The selected candidate RGs were analysed by RT-qPCR. [score:1]
One microRNA, miR-940, had an M-value above the exclusion limit of 1.5 (M = 5.43), making it unsuitable as a RG (Fig.   1a). [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Liu X. Kwong A. Sihoe A. Chu K. M. Plasma miR-940 may serve as a novel biomarker for gastric cancer Tumour Biol. [score:1]
Several circulating miRNAs were identified as biomarkers for the detection and diagnosis of GC: miR-21, miR-200c, miR-421, miR-199a, miR-122, miR-192, miR-222, miR-16, miR-25, miR-92a, miR-451, miR-486-5p, miR-940, miR-223, miR-19b, miR-194, miR-141, and miR-1233, with a reasonable degree of diagnostic ability [25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36]. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 2
Liang D. Xu X. Deng F. Feng J. Zhang H. Liu Y. Zhang Y. Pan L. Liu Y. Zhang D. miRNA-940 reduction contributes to human Tetralogy of Fallot development J. Cell. [score:2]
[1 to 20 of 1 sentences]
34
[+] score: 1
Interestingly, mRNAs correlated with four core response miRNAsmiR-155–5p, miR-505–3p, miR-7-5p and miR-940 – showed an enrichment in innate immune functions (e. g. innate immune response, immune system process and response to bacterium) [55]. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
Mutant allele T interrupts binding-site of miR-1207-5p while creating new binding-sites for miR-940/4514/4692. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
Other miRNAs from this paper: hsa-mir-3677, hsa-mir-4717
The genes are E4F1, DNASE1L2, ECI1, RNPS1, and ABCA3; miRNAs are MIR3677, MIR940, and MIR4717 (Table 1). [score:1]
[1 to 20 of 1 sentences]